Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3128 URS00002AA55A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3128: Hsa-mir-3128 is a microRNA (miRNA) that is likely to occur in a data set of mRNA-miRNA interactions [PMC9615157]. In the study, the most significant pairs in the data set were identified, including hsa-mir-3128 and ELAV Like RNA Binding Protein 3 (ELAVL3) [PMC9615157]. Additionally, hsa-mir-3128 was found to potentially bind to a site at the GREM1 3'-UTR [PMC8202882]. In another study, hsa-mir-3128 was identified as one of the top 10 upregulated differentially expressed miRNAs in BN tissue samples compared to controls [PMC7057810]. Furthermore, hsa-mir-3128 was found to be significantly upregulated in both NDV-6h and NDV-12h groups compared to a mock group [PMC8211993]. Finally, it was discovered that seq-40419_x16 shares a seed sequence with hsa-mir-3128 [PMC4433274]. References: [PMC9615157] - Article: "miRNet-dissecting miRNA-target interactions and functional associations through network-based visual analysis" - https://pubmed.ncbi.nlm.nih.gov/33733710/ [PMC8202882] - Article: "A functional variant at GREM1 influences the risk of colorectal cancer by modulating miR‑185‑5p/hsa‑mir‑221‑5p binding" - https://pubmed.ncbi.nlm.nih.gov/33495816/ [PMC7057810] - Article: "Identification of differentially expressed microRNAs in brown adipose tissue from obese rat by deep sequencing" - https://pubmed.ncbi.nlm.nih.gov/31966019/ [PMC8211993] - Article: "Integrated analysis of miRNA and mRNA expression profiles reveals functional miRNA-target interactions in chicken trachea in response to NDV infection" - https://pubmed.ncbi.nlm.nih.gov/33472612/ [PMC4433274] - Article: "Identification of novel miRNAs and miRNA dependent developmental shifts of gene expression in Arabidopsis thaliana" - https://pubmed.ncbi.nlm.nih.gov/25789973/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGGCAAGUAAAAAACUCUCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications