Homo sapiens (human) hsa-miR-374a-5p URS000029E173_9606

• 22 nucleotides
• 8 databases (ENA, GeneCards, LncBase, MalaCards, miRBase, MirGeneDB, RefSeq, TarBase)
• Found in 12 other species
• 726 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UUAUAAUACAACCUGAUAAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Bos taurus bta-miR-374a
2. Canis lupus familiaris Cfa-Mir-374-P1_5p (mature (co-guide))
3. Cavia porcellus cpo-miR-374-5p
4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-374a-5p
5. Equus caballus eca-miR-374a
6. Macaca mulatta (Rhesus monkey) mml-miR-374a-5p
7. Oryctolagus cuniculus (rabbit) ocu-miR-374a-5p
8. Ovis aries (sheep) oar-miR-374a
9. Pan troglodytes ptr-miR-374a
10. Pongo pygmaeus (Bornean orangutan) ppy-miR-374a
11. Sus scrofa ssc-miR-374a-5p
12. Tupaia chinensis tch-miR-374a-5p

Publications Download

• FASTA
• JSON