Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-204-5p URS000029D9F1_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (MirGeneDB, MalaCards, TarBase, ENA, miRBase, PSICQUIC, GeneCards, IntAct, LncBase, RefSeq). Homo sapiens (human) hsa-miR-204-5p sequence is a product of miR-204-5p, hsa-miR-204, hsa-miR-204-5p, miR-204, MIR204 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 182-FIP, 19A, 4.1B, 5'OY11.1, 80K-L, 82-FIP, A4, A4-LSB, AASD-PPT.

Interactions 15

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-204-5p interacts with:

Interaction id Participant Synonyms
EBI-22114452 intact:EBI-21253771 EBI-21253771 ENST00000380874 mrna_foxc1
URS000029D9F1_9606-0 P01584 P01584
URS000029D9F1_9606-7 P01584 P01584
URS000029D9F1_9606-1 P10415 P10415
URS000029D9F1_9606-8 P10415 P10415
URS000029D9F1_9606-9 P14780 P14780
URS000029D9F1_9606-2 P14780 P14780
URS000029D9F1_9606-6 P15336 P15336
URS000029D9F1_9606-10 P15336 P15336
URS000029D9F1_9606-11 P29323 P29323
URS000029D9F1_9606-3 P29323 P29323
URS000029D9F1_9606-4 Q06945 Q06945
URS000029D9F1_9606-12 Q06945 Q06945
URS000029D9F1_9606-5 Q15389 Q15389
URS000029D9F1_9606-13 Q15389 Q15389

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUCCCUUUGUCAUCCUAUGCCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 59 other species

    1. Alligator mississippiensis (American alligator) ami-miR-204-5p
    2. Anolis carolinensis aca-miR-204a-5p
    3. Bos taurus bta-miR-204
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-204
    5. Callorhinchus milii (elephant shark) Cmi-Mir-204-P1_5p (mature (guide))
    6. Canis lupus familiaris cfa-miR-204
    7. Capra hircus chi-miR-204-5p
    8. Cavia porcellus cpo-miR-204-5p
    9. Cervus elaphus (red deer) cel-miR-204
    10. Chiloscyllium plagiosum microRNA cpl-miR-204
    11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-204-P1_5p (mature (guide))
    12. Chrysemys picta cpi-miR-204-5p
    13. Columba livia (rock pigeon) cli-miR-204-5p
    14. Cricetulus griseus (Chinese hamster) cgr-miR-204
    15. Danio rerio (zebrafish) dre-miR-204-5p
    16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-204-5p
    17. Echinops telfairi Ete-Mir-204-P2_5p (mature (guide))
    18. Equus caballus (horse) eca-miR-204b
    19. Gadus morhua (Atlantic cod) gmo-miR-204-5p
    20. Gallus gallus gga-miR-211
    21. Gekko japonicus Gja-Mir-204-P1_5p (mature (guide))
    22. Gorilla gorilla (western gorilla) ggo-miR-204
    23. Haplochromis burtoni abu-miR-204
    24. Ictalurus punctatus ipu-miR-204
    25. Latimeria chalumnae (coelacanth) Lch-Mir-204-P1_5p (mature (guide))
    26. Lepisosteus oculatus Loc-Mir-204-P1_5p (mature (guide))
    27. Macaca mulatta (Rhesus monkey) mml-miR-204-5p
    28. Macaca nemestrina (pig-tailed macaque) mne-miR-204
    29. Maylandia zebra (zebra mbuna) mze-miR-204
    30. Microcaecilia unicolor Mun-Mir-204-P1_5p (mature (guide))
    31. Microcebus murinus (gray mouse lemur) mmr-miR-204
    32. Monodelphis domestica mdo-miR-204
    33. Monopterus albus Mal-Mir-204-P1b_5p (mature (guide))
    34. Mus musculus (house mouse) mmu-miR-204-5p
    35. Neolamprologus brichardi nbr-miR-204
    36. Ophiophagus hannah oha-miR-204-5p
    37. Oreochromis niloticus oni-miR-204a
    38. Ornithorhynchus anatinus oan-miR-204-5p
    39. Oryctolagus cuniculus ocu-miR-204-5p
    40. Pan paniscus (pygmy chimpanzee) ppa-miR-204
    41. Pan troglodytes (chimpanzee) ptr-miR-204
    42. Petromyzon marinus pma-miR-204-5p
    43. Pongo pygmaeus ppy-miR-204
    44. Pteropus alecto pal-miR-204-5p
    45. Pundamilia nyererei pny-miR-204
    46. Python bivittatus (Burmese python) Pbv-Mir-204-P1_5p (mature (guide))
    47. Rattus norvegicus (Norway rat) rno-miR-204-5p
    48. Saguinus labiatus sla-miR-204
    49. Salmo salar ssa-miR-204-5p
    50. Sarcophilus harrisii Sha-Mir-204-P1_5p (mature (guide))
    51. Scyliorhinus torazame Sto-Mir-204-P2_5p (mature (guide))
    52. Sphenodon punctatus (tuatara) Spt-Mir-204-P2_5p (mature (guide))
    53. Sus scrofa ssc-miR-204
    54. Taeniopygia guttata tgu-miR-204
    55. Takifugu rubripes (torafugu) fru-miR-204a
    56. Tetraodon nigroviridis tni-miR-204a
    57. Tor tambroides miR-204-5p
    58. Xenopus laevis (African clawed frog) Xla-Mir-204-P1c_5p (mature (guide))
    59. Xenopus tropicalis (tropical clawed frog) xtr-miR-204
    Publications New