v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Xenopus laevis (African clawed frog) xla-miR-194 URS000029C2DC_8355

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Xenopus laevis. Annotated by 2 databases (miRBase, MirGeneDB).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    UGUAACAGCAACUCCAUGUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 38 other species

    1. Anolis carolinensis aca-miR-194-5p
    2. Ateles geoffroyi (black-handed spider monkey) age-miR-194
    3. Bos taurus (cattle) bta-miR-194
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-194
    5. Callorhinchus milii Cmi-Mir-194-P1_5p (mature (guide))
    6. Canis lupus familiaris cfa-miR-194
    7. Capra hircus (goat) chi-miR-194
    8. Cervus elaphus (red deer) cel-miR-194
    9. Chrysemys picta cpi-miR-194-5p
    10. Cricetulus griseus cgr-miR-194
    11. Cyprinus carpio ccr-miR-194
    12. Eptatretus burgeri Ebu-Mir-194-o1_5p (mature (guide))
    13. Eptesicus fuscus (big brown bat) efu-miR-194
    14. Equus caballus eca-miR-194
    15. Gadus morhua gmo-miR-194a-5p
    16. Gallus gallus gga-miR-194
    17. Gorilla gorilla ggo-miR-194
    18. Haplochromis burtoni abu-miR-194a
    19. Homo sapiens hsa-miR-194-5p
    20. Ictalurus punctatus (channel catfish) ipu-miR-194a
    21. Macaca mulatta (Rhesus monkey) mml-miR-194-5p
    22. Macaca nemestrina (pig-tailed macaque) mne-miR-194
    23. Maylandia zebra mze-miR-194a
    24. Mus musculus mmu-miR-194-5p
    25. Neolamprologus brichardi nbr-miR-194a
    26. Ophiophagus hannah (king cobra) oha-miR-194-5p
    27. Oreochromis niloticus oni-miR-194a
    28. Ornithorhynchus anatinus oan-miR-194-5p
    29. Ovis aries oar-miR-194
    30. Pan troglodytes ptr-miR-194
    31. Petromyzon marinus Pma-Mir-194-o1_5p (mature (guide))
    32. Pongo pygmaeus ppy-miR-194
    33. Pundamilia nyererei pny-miR-194a
    34. Python bivittatus pbv-miR-194-5p
    35. Rattus norvegicus (Norway rat) rno-miR-194-5p
    36. Salmo salar (Atlantic salmon) ssa-miR-194a-5p
    37. Taeniopygia guttata (zebra finch) tgu-miR-194-5p
    38. Xenopus tropicalis xtr-miR-194
     Publications