Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-194-5p URS000029C2DC_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 6 databases (RefSeq, LncBase, miRBase, PirBase, ENA, TarBase). Described in 35 papers. Mus musculus (house mouse) mmu-miR-194-5p sequence is a product of mmu-miR-194-5p, miR-194, mmu-miR-194, 194, Mir194-2, miR-194-5p, Mir194-1 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610008P16Rik, 0610016O18Rik, 0610025G21Rik, 0610030G24Rik, 0710001O03Rik, 0710008J23Rik, 0910001L17Rik, 100kDa, 107kDa, 1100001F19Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUAACAGCAACUCCAUGUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 35 other species

    1. Anolis carolinensis aca-miR-194-5p
    2. Ateles geoffroyi (black-handed spider monkey) age-miR-194
    3. Bos taurus (cattle) bta-miR-194
    4. Callithrix jacchus cja-miR-194
    5. Callorhinchus milii (elephant shark) eshark_mir-194_1
    6. Canis lupus familiaris cfa-miR-194
    7. Capra hircus (goat) chi-miR-194
    8. Cervus elaphus (red deer) cel-miR-194
    9. Chrysemys picta cpi-miR-194-5p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-194
    11. Cyprinus carpio ccr-miR-194
    12. Eptesicus fuscus (big brown bat) efu-miR-194
    13. Equus caballus (horse) eca-miR-194
    14. Gadus morhua (Atlantic cod) gmo-miR-194a-5p
    15. Gallus gallus (chicken) gga-miR-194
    16. Gorilla gorilla ggo-miR-194
    17. Haplochromis burtoni abu-miR-194a
    18. Homo sapiens hsa-miR-194-5p
    19. Ictalurus punctatus (channel catfish) ipu-miR-194a
    20. Macaca mulatta (Rhesus monkey) mml-miR-194-5p
    21. Macaca nemestrina mne-miR-194
    22. Maylandia zebra mze-miR-194a
    23. Neolamprologus brichardi nbr-miR-194a
    24. Ophiophagus hannah (king cobra) oha-miR-194-5p
    25. Oreochromis niloticus oni-miR-194a
    26. Ornithorhynchus anatinus (platypus) oan-miR-194-5p
    27. Ovis aries oar-miR-194
    28. Pan troglodytes (chimpanzee) ptr-miR-194
    29. Pongo pygmaeus ppy-miR-194
    30. Pundamilia nyererei pny-miR-194a
    31. Python bivittatus pbv-miR-194-5p
    32. Rattus norvegicus (Norway rat) rno-miR-194-5p
    33. Salmo salar (Atlantic salmon) ssa-miR-194a-5p
    34. Taeniopygia guttata tgu-miR-194-5p
    35. Xenopus laevis (African clawed frog) xla-miR-194
    36. Xenopus tropicalis xtr-miR-194