Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-194-5p URS000029C2DC_10090

Automated summary: This piRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 6 databases (LncBase, RefSeq, PirBase, TarBase, ENA, miRBase). Mus musculus (house mouse) mmu-miR-194-5p sequence is a product of 194, miR-194, mmu-miR-194, mmu-miR-194-5p, Mir194-1, Mir194-2, miR-194-5p genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610008P16Rik, 0610016O18Rik, 0610025G21Rik, 0610030G24Rik, 0710001O03Rik, 0710008J23Rik, 0910001L17Rik, 100kDa, 107kDa, 1100001F19Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGUAACAGCAACUCCAUGUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 38 other species

    1. Anolis carolinensis (green anole) aca-miR-194-5p
    2. Ateles geoffroyi (black-handed spider monkey) age-miR-194
    3. Bos taurus (cattle) bta-miR-194
    4. Callithrix jacchus cja-miR-194
    5. Callorhinchus milii (elephant shark) Cmi-Mir-194-P1_5p (mature (guide))
    6. Canis lupus familiaris (dog) cfa-miR-194
    7. Capra hircus (goat) chi-miR-194
    8. Cervus elaphus (red deer) cel-miR-194
    9. Chrysemys picta cpi-miR-194-5p
    10. Cricetulus griseus cgr-miR-194
    11. Cyprinus carpio ccr-miR-194
    12. Eptatretus burgeri (inshore hagfish) Ebu-Mir-194-o1_5p (mature (guide))
    13. Eptesicus fuscus efu-miR-194
    14. Equus caballus (horse) eca-miR-194
    15. Gadus morhua (Atlantic cod) gmo-miR-194a-5p
    16. Gallus gallus (chicken) gga-miR-194
    17. Gorilla gorilla ggo-miR-194
    18. Haplochromis burtoni abu-miR-194a
    19. Homo sapiens hsa-miR-194-5p
    20. Ictalurus punctatus ipu-miR-194a
    21. Macaca mulatta mml-miR-194-5p
    22. Macaca nemestrina mne-miR-194
    23. Maylandia zebra mze-miR-194a
    24. Neolamprologus brichardi nbr-miR-194a
    25. Ophiophagus hannah oha-miR-194-5p
    26. Oreochromis niloticus (Nile tilapia) oni-miR-194a
    27. Ornithorhynchus anatinus oan-miR-194-5p
    28. Ovis aries (sheep) oar-miR-194
    29. Pan troglodytes ptr-miR-194
    30. Petromyzon marinus (sea lamprey) Pma-Mir-194-o1_5p (mature (guide))
    31. Pongo pygmaeus ppy-miR-194
    32. Pundamilia nyererei pny-miR-194a
    33. Python bivittatus pbv-miR-194-5p
    34. Rattus norvegicus (Norway rat) rno-miR-194-5p
    35. Salmo salar ssa-miR-194a-5p
    36. Taeniopygia guttata (zebra finch) tgu-miR-194-5p
    37. Xenopus laevis xla-miR-194
    38. Xenopus tropicalis (tropical clawed frog) xtr-miR-194
    Publications New