Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ricinus communis (castor bean) rco-miR171b URS0000298E0C_3988

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGAGCCGUGCCAAUAUCACG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Aegilops tauschii ata-miR171c-3p
  2. Arabidopsis lyrata (lyrate rockcress) aly-miR171c-3p
  3. Arabidopsis thaliana (thale cress) ath-miR171c-3p
  4. Brassica napus (rape) bna-miR171c
  5. Brassica oleracea (wild cabbage) bol-miR171a
  6. Brassica rapa bra-miR171d
  7. Camelina sativa (false flax) cas-miR171c-3p
  8. Cucumis melo cme-miR171b
  9. Cynara cardunculus var. scolymus cca-miR171b
  10. Glycine max (soybean) gma-miR171i-3p
  11. Linum usitatissimum lus-miR171i
  12. Malus domestica mdm-miR171f-3p
  13. Manihot esculenta (cassava) mes-miR171b
  14. Medicago truncatula mtr-miR171f
  15. Nicotiana attenuata microRNA mir-171-like
  16. Populus tomentosa Pto-miR171a-3p
  17. Populus trichocarpa (black cottonwood) ptc-miR171b
  18. Salvia sclarea (clary) ssl-miR171a
  19. Solanum lycopersicum (tomato) sly-miR171b-3p
  20. Solanum tuberosum (potato) stu-miR171d-3p
  21. Triticum aestivum (bread wheat) tae-miR171b
Publications