Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 69 (SNORA69) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 69 (SNORA69) URS00002982D8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA69: SNORA69, also known as U69, is a small nucleolar RNA (snoRNA) that has been identified as the most up-regulated snoRNA in individuals with more severe autism spectrum disorder (ASD) symptoms [PMC8235321]. The exact role of SNORA69 in ASD is not yet known, but its up-regulation suggests that it may be involved in the pathology of the disorder [PMC8235321]. Manual inspection of novel regions also revealed that SNORA69 overlaps with other snoRNAs, a predicted novel miRNA, a known miRNA not in miRBase, and a small zinc-finger protein [PMC4875694]. In addition to SNORA69, other snoRNAs such as SNORD42A (U42) have been identified as the most down-regulated snoRNAs in individuals with more severe ASD symptoms [PMC8235321]. The dysregulation of these snoRNAs suggests that they may play a role in ASD pathology and warrants further investigation [PMC8235321]. References: - [PMC8235321]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8235321/ - [PMC4875694]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4875694/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAGCAGGUUGCAAUUACAGUGCUUCAUUUUGUGGAAGUACUGCCAUUAUCCUGCUGAAAGAAAAGCCGUGUUAAUCAUUUUUGAUUUUGCCUUUAUGAGGGUAAAAUCAUGACAGAUUGACAUGGACAAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications