Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-211-3p URS000028F5B7_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-211: Mmu-mir-211, a specific type of microRNA, has been extensively studied in various contexts [PMC6599052]. Hybridization for mmu-mir-211 was performed at 48 °C [PMC6599052]. To analyze mmu-mir-211 using qRT-PCR, a specific reverse transcription primer and PCR primers were utilized [PMC6599052]. In Apc-mutant ESCs, mmu-mir-211 has been found to be up-regulated in a Wnt dosage-dependent manner [PMC3642041]. In a study, the effects of mmu-mir-211 on UTR reporter plasmids were investigated through co-transfection with mmu-mir-211 mimic or non-targeting oligos [PMC3642041]. Stable clones overexpressing mmu-mir-211 were generated to further explore its function [PMC3642041]. Additionally, mmu-mir-211 was found to be downregulated in LPS-treated mice, along with other miRNAs such as mmu-miR-376a and mmu-miR-466b-3p, while miRNAs such as mmu-miR-155 and mmu-miR223 were upregulated [PMC7732439].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAAGGACAGCAAAGGGGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications