Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-let-7d-3p URS000028D142_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 5 databases (TarBase, PirBase, ENA, RefSeq, miRBase). Described in 21 papers. Mus musculus (house mouse) mmu-let-7d-3p sequence is a product of let-7d, Mirlet7d, let-7, mmu-let-7d, mmu-let-7d-3p, let-7d-3p genes. Interacts with protein-coding genes, including 2700010L10Rik, 8430423A01Rik, ENSMUSG00000026434, ENSMUSG00000040850, Nucks, Nucks1, Psme4.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUAUACGACCUGCUGCCUUUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Cavia porcellus (domestic guinea pig) cpo-let-7d-3p
    2. Cervus elaphus (red deer) cel-let-7d*
    3. Cricetulus griseus cgr-let-7d-3p
    4. Dasypus novemcinctus (nine-banded armadillo) dno-let-7d-3p
    5. Homo sapiens hsa-let-7d-3p
    6. Oryctolagus cuniculus (rabbit) ocu-let-7d-3p
    7. Rattus norvegicus rno-let-7d-3p
    8. Sus scrofa ssc-let-7d-3p
    9. Tursiops truncatus let-7d