Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 22 (SNORA22) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 22 (SNORA22) URS000028CE2F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA22: SNORA22 is one of the 20 snoRNAs mentioned in the text and is upregulated in both proliferating normal B-cells and proliferating CLL cells, indicating its potential functional relevance for proliferation [PMC9219770]. SNORA22 is part of the three-segment structures in data set three, along with HCV_X3, SCARNA16, His_leader, 5S, PyrR, and ROSE [PMC10159002]. The upregulation of SNORA22 in both normal B-cells and CLL cells suggests its potential involvement in cellular proliferation [PMC9219770]. This finding suggests that SNORA22 may play a role in regulating cell growth and division. The presence of SNORA22 within the three-segment structures suggests its involvement in RNA processing or modification [PMC10159002]. The specific function of SNORA22 within these structures is not mentioned in the text. However, snoRNAs are known to guide chemical modifications on other RNA molecules such as rRNA or snRNA [PMC9219770]. Further research is needed to fully understand the functional relevance and mechanisms of action for SNORA22.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCACAGUGAACACCCAAGUGUGCUUUAUAGUUCCCUUGGCUUUGACCCUGUGCUAGAGCAUUGCCUGCUCUUCUCCUCUGCAUUAAAAGGAAUAUUUAUCCUUUUAAAUGUAUUCAGAAAGCCAGCACAUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications