Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) dme-miR-34-5p URS0000281B10_7227

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dme-mir-34: dme-mir-34 is a miRNA found in Drosophila melanogaster. It has multiple targets in zygotic mRNA transcripts [PMC3632126]. The mammalian homologue of dme-mir-34 is associated with cell cycle regulation and is implicated in various cancers [PMC3632126]. LNA against dme-mir-34 was used to detect its expression in unfertilized Drosophila oocytes [PMC3632126]. In higher organisms, such as fish and mammals, the miR-34 family has diversified to include miR-34a, b, and c, while Drosophila has a single paralogue of miR-34 [PMC3632126]. dme-mir-34 is maternally inherited and important for neurogenesis in Drosophila melanogaster [PMC5852578]. It is also involved in metamorphosis development along with other miRNAs such as Dme-let-7, Dme-miR-100, Dme-miR-125, and Dme-miR-14 [PMC5689003]. The shorter isoforms of dme-mir-34 are enriched with Ago1 protein while the longer isoforms are not associated with any Ago proteins [PMC3268580]. The 21nt isoform of dme-mir-34 is the most abundant at adult stages in D. melanogaster [PMC3268580]. It has been found to modulate aging and neurodegeneration in flies [PMC4462583]. Additionally, dme-mir 11 and dme mir 184 are also implicated in photoperiodism and diapause along with dme mir 34[ PMC9100521].

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCAGUGUGGUUAGCUGGUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

Publications