Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4660 URS00002768C0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4660: Hsa-mir-4660 is a microRNA that has been identified in various studies. It has been found to be one of the top 10 PLK1 mRNA-targeting miRNAs [PMC9811677]. It is also part of the intersection of miRNAs that target specific mRNAs [PMC7997684]. Hsa-mir-4660 is one of the miRNAs that target circRNA_13301 in a ceRNA network [PMC8063878]. Its expression has been detected using the TaqMan microRNA assay [PMC8039776]. Hsa-mir-4660 has also been associated with several genes in different cancers, including prostate, breast, ovarian, and endometrial cancers [PMC9478394] [PMC8427606]. It has been identified as a novel risk-associated miRNA in ovarian cancer and may have onco-suppressor properties [PMC8427606]. Hsa-mir-4660 is also one of the miRNAs that have been observed to have hits based on filtration and site-types criteria [PMC8288231]. Overall, hsa-mir-4660 appears to be a versatile microRNA with potential implications in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCAGCUCUGGUGGAAAAUGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications