Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-34b-3p URS000027352D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-34b: In this group of microRNAs, hsa-mir-29a, hsa-mir-34b, hsa-mir-146b, hsa-mir-22, and hsa-mir-29b are considered risky microRNAs, while hsa-mir-181d, hsa-mir-454-3p, and hsa-mir-9 are protective microRNAs [PMC3849715]. The expressions of hsa-mir-34b and hsa-miR-130a were significantly down-regulated and the respective target genes CDC6 and DTX4 were significantly up-regulated in nasopharyngeal carcinoma (NPC) samples (p<0.01) [PMC4928598]. These findings suggest a potential relationship between the down-regulation of hsa-miR-34b and hsa-miR-130a and the up-regulation of CDC6 and DTX4 in NPC. However, further research is needed to fully understand the role and mechanism of action of hsa-miR-34b and hsa-miR-130a in NPC. References: [PMC3849715] - Liu N., Jiang N., Guo R., Jiang W., He Q.M., Xu Y.F., Li Y.Q. (2013). MiR‐146a‐5p promotes nasopharyngeal carcinoma cell survival thereby increasing both cell survival and invasion by targeting TRAF6. Cancer Res Treat. 45(3): 236–244. [PMC4928598] - Li W.F., Dai H.Q., Ou Q.F., Zuo G.Q., Liu C.A. (2016). Overexpression of CDC6 promotes cell proliferation and is associated with poor prognosis in human nasopharyngeal carcinoma. Mol Med Rep. 13(2): 1769–1775.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAUCACUAACUCCACUGCCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications