Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-590-3p URS0000272039_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-590: Hsa-mir-590 is a microRNA that has been studied in the context of cardiomyocyte proliferation in mice heart [PMC8866653]. A study using AAV9-based delivery of hsa-mir-590 and has-miR-199 demonstrated stable expression and an increase in cardiomyocyte proliferation [PMC8866653]. This suggests that hsa-mir-590 may play a role in promoting the proliferation of cardiomyocytes. Additionally, the study found an inverse association between MED10 and tumor-suppressor microRNAs, including hsa-mir-590 [PMC8792749]. This suggests that MED10 may be functionally co-expressed with hsa-mir-590 but has an opposite effect on tumor-suppressor microRNAs [PMC8792749]. These findings provide insights into the potential role of hsa-mir-590 in cardiac regeneration and its association with MED10 and tumor-suppressor microRNAs. Further research is needed to fully understand the mechanisms underlying these associations and to explore potential therapeutic applications for hsa-mir-590 in cardiac regeneration.

mRNA interactions 4 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUUUUAUGUAUAAGCUAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Canis lupus familiaris (dog) cfa-miR-590
  2. Cervus elaphus (red deer) cel-miR-590
  3. Equus caballus eca-miR-590-3p
  4. Microcebus murinus (gray mouse lemur) mmr-miR-590
  5. Mus musculus (house mouse) mmu-miR-590-3p
  6. Pan troglodytes ptr-miR-590
  7. Pongo pygmaeus (Bornean orangutan) ppy-miR-590-3p
  8. Sus scrofa ssc-mir2
Publications