Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ornithorhynchus anatinus (platypus) oan-miR-199-3p URS0000270C19_9258

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Ornithorhynchus anatinus. Annotated by 3 databases (RefSeq, miRBase, ENA). Described in 4 papers. Ornithorhynchus anatinus (platypus) oan-miR-199-3p sequence is a product of miR-199-3p, miR-199, MIR199, oan-miR-199-3p, oan-miR-199 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACAGUAGUCUGCACAUUGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 96 other species

    1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-199
    2. Callorhinchus milii (elephant shark) eshark_mir-199_2
    3. Canis lupus familiaris (dog) cfa-miR-199
    4. Capra hircus (goat) chi-miR-199b-3p
    5. Cervus elaphus cel-miR-199a-3p
    6. Cricetulus griseus cgr-miR-199a-3p
    7. Cyprinus carpio (common carp) ccr-miR-199-3p
    8. Daubentonia madagascariensis (aye-aye) dma-miR-199
    9. Gadus morhua gmo-miR-199-4-3p
    10. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-199-3p
    11. Ictalurus punctatus ipu-miR-199a-3p
    12. Maylandia zebra mze-miR-199
    13. Microcebus murinus mmr-miR-199
    14. Monodelphis domestica (gray short-tailed opossum) mdo-miR-199b-3p
    15. Mus musculus Mus_musculus piRNA piR-mmu-72468
    16. Neolamprologus brichardi nbr-miR-199
    17. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-199a
    18. Oreochromis niloticus (Nile tilapia) oni-miR-199a
    19. Otolemur garnettii oga-miR-199
    20. Ovis aries (sheep) oar-miR-199a-3p
    21. Pan paniscus ppa-miR-199b
    22. Papio hamadryas (hamadryas baboon) pha-miR-199
    23. Pteropus alecto (black flying fox) pal-miR-199-3p
    24. Pundamilia nyererei pny-miR-199
    25. Python bivittatus (Burmese python) pbv-miR-199-3p
    26. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63005
    27. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-199
    28. Salmo salar ssa-miR-199a-3p
    29. Sarcophilus harrisii (Tasmanian devil) sha-miR-199a
    30. Taeniopygia guttata tgu-miR-199-3p
    31. Tupaia chinensis tch-miR-199b-3p
    32. Xenopus laevis (African clawed frog) xla-miR-199a*
    33. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-2516034