Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Microcebus murinus (gray mouse lemur) mmr-miR-199 URS0000270C19_30608

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Microcebus murinus. Annotated by 1 database (miRBase). Found in the Microcebus murinus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    ACAGUAGUCUGCACAUUGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 33 other species

    1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-199
    2. Callorhinchus milii eshark_mir-199_2
    3. Canis lupus familiaris cfa-miR-199
    4. Capra hircus (goat) chi-miR-199b-3p
    5. Cervus elaphus (red deer) cel-miR-199a-3p
    6. Cricetulus griseus cgr-miR-199a-3p
    7. Cyprinus carpio ccr-miR-199-3p
    8. Daubentonia madagascariensis (aye-aye) dma-miR-199
    9. Gadus morhua gmo-miR-199-4-3p
    10. Haplochromis burtoni abu-miR-199-3p
    11. Ictalurus punctatus (channel catfish) ipu-miR-199a-3p
    12. Maylandia zebra mze-miR-199
    13. Monodelphis domestica mdo-miR-199b-3p
    14. Mus musculus Mus_musculus piRNA piR-mmu-72468
    15. Neolamprologus brichardi nbr-miR-199
    16. Nomascus leucogenys nle-miR-199a
    17. Oreochromis niloticus oni-miR-199a
    18. Ornithorhynchus anatinus oan-miR-199-3p
    19. Otolemur garnettii (small-eared galago) oga-miR-199
    20. Ovis aries oar-miR-199a-3p
    21. Pan paniscus (pygmy chimpanzee) ppa-miR-199b
    22. Papio hamadryas pha-miR-199
    23. Pteropus alecto (black flying fox) pal-miR-199-3p
    24. Pundamilia nyererei pny-miR-199
    25. Python bivittatus pbv-miR-199-3p
    26. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63005
    27. Saimiri boliviensis boliviensis sbo-miR-199
    28. Salmo salar (Atlantic salmon) ssa-miR-199a-3p
    29. Sarcophilus harrisii sha-miR-199a
    30. Taeniopygia guttata (zebra finch) tgu-miR-199-3p
    31. Tupaia chinensis (Chinese tree shrew) tch-miR-199a-3p
    32. Xenopus laevis (African clawed frog) xla-miR-199a*
    33. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2516034