Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-199b-3p URS0000270C19_13616

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Monodelphis domestica. Annotated by 3 databases (ENA, RefSeq, miRBase). Monodelphis domestica (gray short-tailed opossum) mdo-miR-199b-3p sequence is a product of MIR199B-3, miR-199b-3p, miR-199b, mdo-miR-199b, MIR199B-1, mdo-miR-199b-3p, MIR199B-2, miR-199 genes. Found in the gray short-tailed opossum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    ACAGUAGUCUGCACAUUGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 33 other species

    1. Callithrix jacchus cja-miR-199
    2. Callorhinchus milii (elephant shark) eshark_mir-199_2
    3. Canis lupus familiaris (dog) cfa-miR-199
    4. Capra hircus (goat) chi-miR-199a-3p
    5. Cervus elaphus (red deer) cel-miR-199a-3p
    6. Cricetulus griseus cgr-miR-199a-3p
    7. Cyprinus carpio ccr-miR-199-3p
    8. Daubentonia madagascariensis dma-miR-199
    9. Gadus morhua (Atlantic cod) gmo-miR-199-4-3p
    10. Haplochromis burtoni abu-miR-199-3p
    11. Ictalurus punctatus ipu-miR-199a-3p
    12. Maylandia zebra mze-miR-199
    13. Microcebus murinus (gray mouse lemur) mmr-miR-199
    14. Mus musculus Mus_musculus piRNA piR-mmu-72468
    15. Neolamprologus brichardi nbr-miR-199
    16. Nomascus leucogenys nle-miR-199a
    17. Oreochromis niloticus (Nile tilapia) oni-miR-199a
    18. Ornithorhynchus anatinus oan-miR-199-3p
    19. Otolemur garnettii oga-miR-199
    20. Ovis aries (sheep) oar-miR-199a-3p
    21. Pan paniscus (pygmy chimpanzee) ppa-miR-199b
    22. Papio hamadryas (hamadryas baboon) pha-miR-199
    23. Pteropus alecto (black flying fox) pal-miR-199-3p
    24. Pundamilia nyererei pny-miR-199
    25. Python bivittatus pbv-miR-199-3p
    26. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63005
    27. Saimiri boliviensis boliviensis sbo-miR-199
    28. Salmo salar ssa-miR-199a-3p
    29. Sarcophilus harrisii sha-miR-199a
    30. Taeniopygia guttata (zebra finch) tgu-miR-199-3p
    31. Tupaia chinensis tch-miR-199a-3p
    32. Xenopus laevis xla-miR-199a*
    33. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-2516034
    Publications New