v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Columba livia (rock pigeon) Cli-Mir-430-P2_3p (mature (guide)) URS000027080C_8932

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAAGUGCUUCCAUGUUUCAGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Alligator mississippiensis Ami-Mir-430-P2_3p (mature (guide))
  2. Bos taurus bta-miR-302c
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-302c
  4. Canis lupus familiaris (dog) Cfa-Mir-430-P2_3p (mature (guide))
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-302c-3p
  6. Equus caballus eca-miR-302c
  7. Gallus gallus gga-miR-302c-3p
  8. Homo sapiens hsa-miR-302c-3p
  9. Macaca mulatta (Rhesus monkey) mml-miR-302c
  10. Monodelphis domestica Mdo-Mir-430-P2_3p (mature (guide))
  11. Ornithorhynchus anatinus (platypus) Oan-Mir-430-P2_3p (mature (guide))
  12. Oryctolagus cuniculus ocu-miR-302c-3p
  13. Pan troglodytes ptr-miR-302c
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-302c
  15. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-430-P2_3p (mature (guide))
  16. Sphenodon punctatus Spt-Mir-430-P2_3p (mature (guide))
  17. Taeniopygia guttata Tgu-Mir-430-P2_3p (mature (guide))