Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-302c-3p URS000027080C_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (GeneCards, LncBase, RefSeq, TarBase, ENA, miRBase, MirGeneDB, MalaCards). Homo sapiens (human) hsa-miR-302c-3p sequence is a product of MIR302C, miR-302c, hsa-miR-302c-3p, miR-302, hsa-miR-302c, miR-302c-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 182-FIP, 2P1, 3D3, 4EHP, 82-FIP, A170, A6, AATYK2, ABC1, ABCA1.

Interactions 2

According to PSICQUIC, Homo sapiens (human) hsa-miR-302c-3p interacts with:

Interaction id Participant Synonyms
URS000027080C_9606-0 P10145 P10145
URS000027080C_9606-1 P10145 P10145

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAAGUGCUUCCAUGUUUCAGUGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 17 other species

    1. Alligator mississippiensis Ami-Mir-430-P2_3p (mature (guide))
    2. Bos taurus (cattle) bta-miR-302c
    3. Callithrix jacchus cja-miR-302c
    4. Canis lupus familiaris (dog) Cfa-Mir-430-P2_3p (mature (guide))
    5. Columba livia (rock pigeon) Cli-Mir-430-P2_3p (mature (guide))
    6. Dasypus novemcinctus dno-miR-302c-3p
    7. Equus caballus (horse) eca-miR-302c
    8. Gallus gallus (chicken) gga-miR-302c-3p
    9. Macaca mulatta mml-miR-302c
    10. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-430-P2_3p (mature (guide))
    11. Ornithorhynchus anatinus Oan-Mir-430-P2_3p (mature (guide))
    12. Oryctolagus cuniculus ocu-miR-302c-3p
    13. Pan troglodytes ptr-miR-302c
    14. Pongo pygmaeus ppy-miR-302c
    15. Sarcophilus harrisii Sha-Mir-430-P2_3p (mature (guide))
    16. Sphenodon punctatus Spt-Mir-430-P2_3p (mature (guide))
    17. Taeniopygia guttata (zebra finch) Tgu-Mir-430-P2_3p (mature (guide))
    Publications New