Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 75 (SNORD75) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 75 (SNORD75) URS000026D828_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD75: SNORD75 is a small nucleolar RNA (snoRNA) that has been studied in the context of lung cancer and its role in RNA processing. Analysis of a small cohort of lung cancer patients using RNA-seq revealed that the level of SNORD75 was significantly decreased in the plasma of lung cancer patients compared to healthy donors [PMC7140444]. SNORD75 is also encoded within the introns of Gas5, along with other box C/D snoRNAs [PMC6856654]. It contains an element for binding splicing regulatory factors, and its deletion can lead to alterations in Gas5 pre-lncRNA maturation [PMC6856654]. Mutations in SNORD75 may prevent the formation of the proper K-turn structure, as observed in monoclones obtained from experiments [PMC6856654]. Additionally, a consensus "DRACH" motif is found within the deleted region of SNORD75 [PMC6856654]. Furthermore, a piRNA derived from SNORD75 has been shown to bind PIWI proteins and facilitate histone mark exchange [PMC8508363]. These findings suggest that SNORD75 plays a role in RNA processing and may have implications for lung cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCCUGUGAUGCUUUAAGAGUAGUGGACAGAAGGGAUUUCUGAAAUUCUAUUCUGAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

2D structure Publications