Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aegilops tauschii ata-miR172c-3p URS0000263070_37682

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ata-miR172c-3p: Ata-mir172c-3p is a conserved miRNA involved in the protein network [PMC7589925]. It is predicted to target the CRF gene [PMC7045451]. Ata-mir172c-3p is part of a subset of APETALA2/ethylene response factor (AP2/ERF) transcription factors that regulate plant development through the cytokinin signal transduction pathway [PMC7045451]. It may play a role in wheat seed development through cytokinin regulation [PMC7045451]. The target gene products of ata-mir172c-3p, such as DnaJ and chaperone binding, are involved in seed development and response to heat stress [PMC7045451]. Ata-mir172c-3p, along with osa-miR171a, miR396s (ata-miR396a-5p, ata-miR396e-5p, and ata-miR396c-5p), ata-miR393-5p_L-1R + 1, and ata-miR5168-3p are relatively more abundant during early stages of wheat grain development [PMC7045451]. These miRNAs may be involved in the early stages of grain development [PMC7045451]. References: [PMC7589925] - Zhang YJ et al. (2020) Identification and characterization of conserved microRNAs involved in protein network during wheat grain development. BMC Plant Biol 20(1): 393. doi: 10.1186/s12870-020-02570-w. [PMC7045451] - Zhang YJ et al. (2020) Identification and characterization of microRNAs during wheat grain development. BMC Genomics 21(1): 6. doi: 10.1186/s12864-019-6412-2.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAAUCUUGAUGAUGCUGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR172b
  2. Arabidopsis thaliana (thale cress) ath-miR172e-3p
  3. Brachypodium distachyon (stiff brome) bdi-miR172b
  4. Brassica napus (rape) bna-miR172c
  5. Brassica rapa (field mustard) bra-miR172d-3p
  6. Cucumis melo cme-miR172d
  7. Glycine max gma-miR172l
  8. Hordeum vulgare miR172
  9. Linum usitatissimum (flax) lus-miR172g
  10. Malus domestica mdm-miR172j
  11. Nicotiana tabacum nta-miR172j
  12. Oryza sativa (Asian cultivated rice) osa-miR172b
  13. Oryza sativa Japonica Group microRNA osa-miR172b
  14. Populus tomentosa Pto-miR172e
  15. Populus trichocarpa ptc-miR172e
  16. Prunus persica (peach) ppe-miR172c
  17. Theobroma cacao tcc-miR172c
  18. Zea mays (maize) zma-miR172e
Publications