Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Populus trichocarpa (black cottonwood) ptc-miR172e URS0000263070_3694

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAAUCUUGAUGAUGCUGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Aegilops tauschii ata-miR172c-3p
  2. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR172b
  3. Arabidopsis thaliana (thale cress) ath-miR172e-3p
  4. Brachypodium distachyon (stiff brome) bdi-miR172b
  5. Brassica napus (rape) bna-miR172c
  6. Brassica rapa (field mustard) bra-miR172d-3p
  7. Cucumis melo cme-miR172d
  8. Glycine max gma-miR172l
  9. Hordeum vulgare miR172
  10. Linum usitatissimum (flax) lus-miR172g
  11. Malus domestica mdm-miR172j
  12. Nicotiana tabacum nta-miR172j
  13. Oryza sativa (Asian cultivated rice) osa-miR172b
  14. Oryza sativa Japonica Group microRNA osa-miR172b
  15. Populus tomentosa Pto-miR172e
  16. Prunus persica (peach) ppe-miR172c
  17. Theobroma cacao tcc-miR172c
  18. Zea mays (maize) zma-miR172e
Publications