Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR172b URS0000263070_39947

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR172b sequence is a product of miR172, osa-miR172b, miR172b genes. Found in the Oryza sativa Japonica Group reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGAAUCUUGAUGAUGCUGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Aegilops tauschii ata-miR172c-3p
    2. Aquilegia coerulea aqc-miR172b
    3. Arabidopsis thaliana ath-miR172e-3p
    4. Brachypodium distachyon (stiff brome) bdi-miR172b
    5. Brassica napus bna-miR172b
    6. Brassica rapa (field mustard) bra-miR172d-3p
    7. Cucumis melo (muskmelon) cme-miR172d
    8. Glycine max (soybean) gma-miR172i-3p
    9. Hordeum vulgare miR172
    10. Linum usitatissimum lus-miR172g
    11. Malus domestica (apple) mdm-miR172j
    12. Nicotiana tabacum nta-miR172j
    13. Oryza sativa osa-miR172b
    14. Populus tomentosa Pto-miR172e
    15. Populus trichocarpa (black cottonwood) ptc-miR172e
    16. Prunus persica (peach) ppe-miR172c
    17. Theobroma cacao tcc-miR172c
    18. Zea mays zma-miR172e