Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Scyliorhinus torazame (cloudy catshark) Sto-Mir-140-v1_5p* (star (passenger)) URS000026261D_75743

  • 22 nucleotides
  • 1 database (MirGeneDB)
  • Found in 33 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGGUUUUACCCUAUGGUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Alligator mississippiensis ami-miR-140-5p
  2. Callorhinchus milii eshark_mir-140_1
  3. Capra hircus (goat) chi-miR-140-5p
  4. Cavia porcellus cpo-miR-140-5p
  5. Cervus elaphus cel-miR-140
  6. Chiloscyllium plagiosum microRNA cpl-miR-140
  7. Chrysemys picta cpi-miR-140-5p
  8. Columba livia cli-miR-140-5p
  9. Cricetulus griseus (Chinese hamster) cgr-miR-140-5p
  10. Cyprinus carpio ccr-miR-140-5p
  11. Danio rerio dre-miR-140-5p
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-140-5p
  13. Eptesicus fuscus (big brown bat) efu-miR-140
  14. Equus caballus eca-miR-140-5p
  15. Homo sapiens hsa-miR-140-5p
  16. Macaca mulatta mml-miR-140-5p
  17. Monodelphis domestica (gray short-tailed opossum) mdo-miR-140-5p
  18. Mus musculus mmu-miR-140-5p
  19. Ophiophagus hannah (king cobra) oha-miR-140-5p
  20. Oryctolagus cuniculus (rabbit) ocu-miR-140-5p
  21. Oryzias latipes (Japanese medaka) ola-miR-140-5p
  22. Ovis aries (sheep) miscellaneous RNA
  23. Paralichthys olivaceus (Japanese flounder) pol-miR-140-5p
  24. Petromyzon marinus (sea lamprey) pma-miR-140
  25. Pongo pygmaeus ppy-miR-140-5p
  26. Pteropus alecto (black flying fox) pal-miR-140-5p
  27. Rattus norvegicus rno-miR-140-5p
  28. Salmo salar (Atlantic salmon) ssa-miR-140-5p
  29. Taeniopygia guttata tgu-miR-140-5p
  30. Takifugu rubripes fru-miR-140
  31. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-140
  32. Tor tambroides miR-140-5p
  33. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3138842