Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-140-5p URS000026261D_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (MirGeneDB, ENA, TarBase, miRBase, GeneCards, MalaCards, LncBase, RefSeq). Described in 61 papers. Homo sapiens (human) hsa-miR-140-5p sequence is a product of hsa-miR-140-5p, hsa-miR-140, miR-140, miR-140-5p, MIR140 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3, 14-3-3GAMMA, 14-3-3γ, 156DAG, 2H9, 53BP2, 6A3-5, 87U6, A20, A2MR.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAGUGGUUUUACCCUAUGGUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 40 other species

    1. Alligator mississippiensis ami-miR-140-5p
    2. Anolis carolinensis Aca-Mir-140-v1_5p* (star (passenger))
    3. Bos taurus (cattle) Bta-Mir-140-v1_5p* (star (passenger))
    4. Callorhinchus milii (elephant shark) eshark_mir-140_1
    5. Canis lupus familiaris Cfa-Mir-140-v1_5p* (star (passenger))
    6. Capra hircus (goat) chi-miR-140-5p
    7. Cavia porcellus (domestic guinea pig) cpo-miR-140-5p
    8. Cervus elaphus (red deer) cel-miR-140
    9. Chiloscyllium plagiosum microRNA cpl-miR-140
    10. Chrysemys picta bellii Cpi-Mir-140-v1_5p* (star (passenger))
    11. Chrysemys picta cpi-miR-140-5p
    12. Columba livia cli-miR-140-5p
    13. Cricetulus griseus (Chinese hamster) cgr-miR-140-5p
    14. Cyprinus carpio ccr-miR-140-5p
    15. Danio rerio (zebrafish) dre-miR-140-5p
    16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-140-5p
    17. Echinops telfairi Ete-Mir-140-v1_5p* (star (passenger))
    18. Eptesicus fuscus (big brown bat) efu-miR-140
    19. Equus caballus (horse) eca-miR-140-5p
    20. Gallus gallus (chicken) Gga-Mir-140-v1_5p* (star (passenger))
    21. Macaca mulatta (Rhesus monkey) mml-miR-140-5p
    22. Monodelphis domestica (gray short-tailed opossum) mdo-miR-140-5p
    23. Mus musculus mmu-miR-140-5p
    24. Ophiophagus hannah (king cobra) oha-miR-140-5p
    25. Ornithorhynchus anatinus (platypus) Oan-Mir-140-v1_5p* (star (passenger))
    26. Oryctolagus cuniculus (rabbit) ocu-miR-140-5p
    27. Oryzias latipes ola-miR-140-5p
    28. Ovis aries miscellaneous RNA
    29. Paralichthys olivaceus pol-miR-140-5p
    30. Petromyzon marinus pma-miR-140
    31. Pongo pygmaeus ppy-miR-140-5p
    32. Pteropus alecto pal-miR-140-5p
    33. Rattus norvegicus (Norway rat) rno-miR-140-5p
    34. Salmo salar (Atlantic salmon) ssa-miR-140-5p
    35. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-140-v1_5p* (star (passenger))
    36. Scyliorhinus torazame (cloudy catshark) Sto-Mir-140-v1_5p* (star (passenger))
    37. Taeniopygia guttata tgu-miR-140-5p
    38. Takifugu rubripes (torafugu) fru-miR-140
    39. Tetraodon nigroviridis tni-miR-140
    40. Tor tambroides miR-140-5p
    41. Xenopus tropicalis Xtr-Mir-140-v1_5p* (star (passenger))