Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-142-3p URS00002620A7_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (ENA, GeneCards, TarBase, MirGeneDB, MalaCards, RefSeq, LncBase, miRBase, IntAct, PSICQUIC). Described in 78 papers. Homo sapiens (human) hsa-miR-142-3p sequence is a product of miR-142-3p, hsa-miR-142, 142a, miR-142, hsa-miR-142-3p, 142as, MIR142, miR-142as genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 156DAG, 15E1.2, 182-FIP, 2700066J21Rik, 2C4D, 5-HTT, 5PTASE, 82-FIP, A3a, A6.

Interactions 5

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-142-3p interacts with:

Interaction id Participant Synonyms
EBI-25434579 intact:EBI-25420098 EBI-25420098 ENST00000627532 mrna_zeb2
EBI-25436002 intact:EBI-25420098 EBI-25420098 ENST00000627532 mrna_zeb2
EBI-25426282 intact:EBI-25426237 EBI-25426237 ENST00000263339 mrna_il1a
URS00002620A7_9606-0 P01583 P01583
URS00002620A7_9606-1 P01583 P01583

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUAGUGUUUCCUACUUUAUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 207 other species

    1. Alligator mississippiensis ami-miR-142-3p
    2. Anolis carolinensis (green anole) Aca-Mir-142-P2-v3_3p (mature (guide))
    3. Artibeus jamaicensis aja-miR-142
    4. Bos taurus (cattle) Bta-Mir-142-P1-v3_3p (mature (guide))
    5. Callorhinchus milii (elephant shark) Cmi-Mir-142-P1-v3_3p (mature (guide))
    6. Canis lupus familiaris Cfa-Mir-142-P1-v3_3p (mature (guide))
    7. Cavia porcellus (domestic guinea pig) Cpo-Mir-142-P1-v3_3p (mature (guide))
    8. Chrysemys picta bellii Cpi-Mir-142-P1-v3_3p (mature (guide))
    9. Columba livia (rock pigeon) Cli-Mir-142-P1-v3_3p (mature (guide))
    10. Danio rerio dre-miR-142a-3p
    11. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-142-P1-v3_3p (mature (guide))
    12. Echinops telfairi Ete-Mir-142-P1-v3_3p (mature (guide))
    13. Eptatretus burgeri (inshore hagfish) Ebu-Mir-142-v3_3p (mature (guide))
    14. Eptesicus fuscus (big brown bat) efu-miR-142
    15. Equus caballus eca-miR-142-3p
    16. Gadus morhua Gmo-Mir-142-P1-v3_3p (mature (guide))
    17. Gallus gallus Gga-Mir-142-P1-v3_3p (mature (guide))
    18. Gekko japonicus Gja-Mir-142-P2-v3_3p (mature (guide))
    19. Lepisosteus oculatus (spotted gar) Loc-Mir-142-P1-v3_3p (mature (guide))
    20. Macaca mulatta (Rhesus monkey) mml-miR-142-3p
    21. Monodelphis domestica (gray short-tailed opossum) mdo-miR-142
    22. Monopterus albus (swamp eel) Mal-Mir-142-P1-v3_3p (mature (guide))
    23. Mus musculus mmu-miR-142a-3p
    24. Ophiophagus hannah oha-miR-142-3p
    25. Ornithorhynchus anatinus Oan-Mir-142-P1-v3_3p (mature (guide))
    26. Oryctolagus cuniculus (rabbit) Ocu-Mir-142-P1-v3_3p (mature (guide))
    27. Pan troglodytes ptr-miR-142
    28. Pongo pygmaeus (Bornean orangutan) ppy-miR-142-3p
    29. Python bivittatus Pbv-Mir-142-P2-v3_3p (mature (guide))
    30. Rattus norvegicus rno-miR-142-3p
    31. Sarcophilus harrisii Sha-Mir-142-P1-v3_3p (mature (guide))
    32. Scyliorhinus torazame (cloudy catshark) Sto-Mir-142-P1-v3_3p (mature (guide))
    33. Taeniopygia guttata (zebra finch) Tgu-Mir-142-P1-v3_3p (mature (guide))
    34. Tetraodon nigroviridis Tni-Mir-142-P1-v3_3p (mature (guide))
    35. Tor tambroides miR-142a-3p
    36. Xenopus laevis (African clawed frog) xla-miR-142-3p
    37. Xenopus tropicalis xtr-miR-142-3p
    Publications New