Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-142a-3p URS00002620A7_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, miRBase, PirBase, ENA, TarBase, MirGeneDB, LncBase). Described in 44 papers. Mus musculus (house mouse) mmu-miR-142a-3p sequence is a product of miR-142a, miR-142, mmu-miR-142a-3p, mmu-miR-142a, miR-142a-3p, Mir142 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007A03Rik, 0610007P08Rik, 0610008F14Rik, 0610009N12Rik, 0610010I17Rik, 0610010I20Rik, 0610010O12Rik, 0610011E17Rik, 0610011F20Rik, 0610011L14Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUAGUGUUUCCUACUUUAUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Alligator mississippiensis ami-miR-142-3p
    2. Anolis carolinensis Aca-Mir-142-P4-v3_3p (mature (guide))
    3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-142
    4. Bos taurus (cattle) Bta-Mir-142-v3_3p (mature (guide))
    5. Canis lupus familiaris Cfa-Mir-142-v3_3p (mature (guide))
    6. Cavia porcellus (domestic guinea pig) Cpo-Mir-142-v3_3p (mature (guide))
    7. Chrysemys picta bellii Cpi-Mir-142-P4-v3_3p (mature (guide))
    8. Columba livia Cli-Mir-142-P3-v3_3p (mature (guide))
    9. Danio rerio (zebrafish) dre-miR-142a-3p
    10. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-142-v3_3p (mature (guide))
    11. Echinops telfairi Ete-Mir-142-v3_3p (mature (guide))
    12. Eptesicus fuscus (big brown bat) efu-miR-142
    13. Equus caballus (horse) eca-miR-142-3p
    14. Gallus gallus (chicken) Gga-Mir-142-P3-v3_3p (mature (guide))
    15. Homo sapiens hsa-miR-142-3p
    16. Macaca mulatta (Rhesus monkey) mml-miR-142-3p
    17. Monodelphis domestica (gray short-tailed opossum) mdo-miR-142
    18. Ophiophagus hannah (king cobra) oha-miR-142-3p
    19. Ornithorhynchus anatinus (platypus) Oan-Mir-142-v3_3p (mature (guide))
    20. Oryctolagus cuniculus (rabbit) Ocu-Mir-142-v3_3p (mature (guide))
    21. Pan troglodytes (chimpanzee) ptr-miR-142
    22. Pongo pygmaeus ppy-miR-142-3p
    23. Rattus norvegicus (Norway rat) rno-miR-142-3p
    24. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-142-v3_3p (mature (guide))
    25. Scyliorhinus torazame (cloudy catshark) Sto-Mir-142-v3_3p (mature (guide))
    26. Taeniopygia guttata Tgu-Mir-142-P3-v3_3p (mature (guide))
    27. Tor tambroides miR-142a-3p
    28. Xenopus laevis (African clawed frog) xla-miR-142-3p
    29. Xenopus tropicalis xtr-miR-142-3p