Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arabidopsis thaliana (thale cress) ath-miR391-3p URS000025EF66_3702

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ath-miR391-3p: Ath-mir391-3p is a small RNA molecule that belongs to the class of microRNAs (miRNAs) in Arabidopsis thaliana [PMC7201365]. It has been found to have predicted target genes that encode PEPR2, GSTU2/U5, and DIR7 [PMC7201365]. Additionally, ath-mir391-3p has been shown to bind to GSTU2 and JRL22 as its targets [PMC7201365]. It is suggested that ath-mir391-3p, along with ath-miR393b-3p and ath-miR472-5p, bind to AGO2 in order to repress the expression of GST and RbohF genes [PMC7201365]. Other genes regulated by ath-mir391-3p include PEPR2, MYC2, ACS2, and RMG1 [PMC7201365]. Ath-mir391-3p is one of the most abundant AGO2-bound small RNAs in Arabidopsis thaliana [PMC7201365]. The integrated analysis of sRNA-seq and RNA-seq data suggests that differentially expressed genes (DEGs) are regulated by ath-mir391-3p as well as ath-miR393b-3p and ath-miR472-5p [PMC7201365]. Reference: [PMC7201365]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACGGUAUCUCUCCUACGUAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Arabidopsis lyrata (lyrate rockcress) aly-miR391-3p
  2. Brassica rapa bra-miR391-3p
Publications