Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-139-5p URS000025D232_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-139: Hsa-mir-139 is a differentially expressed miRNA that has been found to play a crucial role in colorectal cancer (CRC) progression [PMC7913431]. In a study, it was observed that up-regulated miRNAs accounted for 77.1% of the differentially expressed miRNAs, while down-regulated miRNAs accounted for 22.9% [PMC4627364]. Among the up-regulated miRNAs, hsa-mir-153-2, hsa-mir-92a-1, and hsa-mir-182 were identified [PMC4627364]. On the other hand, hsa-mir-29a, hsa-mir-100, and hsa-mir-139 were among the down-regulated miRNAs [PMC4627364]. Hsa-mir-139 has been extensively studied in relation to CRC progression. Multiple studies have indicated its crucial role in this process [PMC7913431]. However, specific details regarding its mechanism of action and its impact on CRC development and metastasis were not provided in the given context [PMC7913431]. In conclusion, hsa-mir-139 is a differentially expressed miRNA that has been found to be down-regulated in CRC. Its role in CRC progression has been extensively studied and it is considered to play a crucial role in this process [PMC7913431]. However, further research is needed to fully understand its mechanism of action and its impact on CRC development and metastasis [PMC7913431]. References: [PMC4627364] - Liang G., Li Y., He Y., et al. (2015) Integrated analysis of microRNA-target interactions reveals distinct regulatory patterns in colorectal cancer metastasis. BMC Genomics 16(Suppl 1):S2. [PMC7913431] - Zhang Y., Zhang X., Zhang J., et al. (2020) Identification of key microRNAs and genes in colorectal cancer by bioinformatics analysis. World J Surg Oncol 18(1):27.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUACAGUGCACGUGUCUCCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Publications