Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 40 (SNORA40) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 40 (SNORA40) URS00002587B6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA40: SNORA40 is a small nucleolar RNA that belongs to the H/ACA box snoRNA family [PMC9413531]. It has been found to be overexpressed in the context of Huntington's disease (HD) compared to non-HD cases, along with other snoRNAs [PMC9413531]. In HD patients, SNORA40 has been shown to be downregulated, along with its host gene TAF1D [PMC8629011]. A mutation in SNORA40 in humans has been found to result in the formation of a modified form of 28S rRNA [PMC6984369]. SNORA40 has also been found to acquire a "compensatory" guide activity when another snoRNA, SNORA25, loses its specificity for 28S rRNA [PMC6984369]. It has been suggested that SNORA40 may play a role in the overall upregulation of the translational machinery in HD tumors [PMC3511933]. Additionally, SNORA40 has been identified as a potential therapeutic target for multiple myeloma [PMC8538251], asthma [PMC4391585], and multiple sclerosis [PMC4391585]. Overall, SNORA40 is an important snoRNA with potential implications in various diseases and biological processes [PMC4391585].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCACUUAUGUAUGUUUUUGUUUAACGUGGACAAAGACUUACAGAUAGGUGCAAAAAAUAAAUCCUCUUUUGCAACCCAGAACUCAUUGUUCAGUAUGAGUUUUGAUACAUAUAAGAAGGGAUAUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications