Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR166l-3p URS0000258493_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR166k-3p: Osa-mir166k-3p is a microRNA that belongs to the miR166 family and is involved in the regulation of various biological processes in rice. It targets LOC_Os03g43930, a START domain containing protein, which is a putative HD-ZIP transcription factor involved in response to abiotic stress and abscisic acid [PMC6042804]. In a study comparing miRNA expression under bleomycin treatment, osa-mir166k-3p was found to be down-regulated [PMC8472271]. Additionally, osa-mir166k-3p was significantly downregulated in response to chilling stress in rice [PMC9002458]. It was observed that osa-mir166k-3p targets four members of the OsHDZIP subfamily III [PMC9405480]. Furthermore, osa-mir166k-3p and sbi-miR166a_R+1_1ss1TG were found to target four common HD-ZIP transcription factors [PMC4448008]. These findings suggest that osa-mir166k-3p plays a regulatory role in response to various stresses and may have different expression patterns and roles depending on the specific stress condition.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGACCAGGCUUCAAUCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Aegilops tauschii ata-miR5168-3p
  2. Ananas comosus (pineapple) microRNA 166k
  3. Brachypodium distachyon bdi-miR166h-3p
  4. Oryza sativa Japonica Group microRNA osa-miR166k-3p
  5. Sorghum bicolor sbi-miR166g
  6. Zea mays (maize) zma-miR166n-3p
Publications