Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1460 tRNA-Gln secondary structure diagram

Saccharomyces cerevisiae YJM1460 tRNA-Gln URS0000258344_1294377

Automated summary: This tRNA sequence is 76 nucleotides long and is found in Saccharomyces cerevisiae YJM1460. Annotated by 1 database (ENA). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAGUCGUAGACUAAUAGGUAAGUUACCAAAAUUUGAGUUUGGAGUUUGUUUGUUCGAAUCAAACCGAUUCAAUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 99 other species

    1. Saccharomyces cerevisiae tRNA-Gln
    2. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Gln
    3. Saccharomyces cerevisiae PE-2 tRNA-Gln
    4. Saccharomyces cerevisiae S288C tRNA-Gln
    5. Saccharomyces cerevisiae x Saccharomyces paradoxus tRNA-Gln
    6. Saccharomyces cerevisiae YJM1078 tRNA-Gln
    7. Saccharomyces cerevisiae YJM1083 tRNA-Gln
    8. Saccharomyces cerevisiae YJM1129 tRNA-Gln
    9. Saccharomyces cerevisiae YJM1133 tRNA-Gln
    10. Saccharomyces cerevisiae YJM1190 tRNA-Gln
    11. Saccharomyces cerevisiae YJM1199 tRNA-Gln
    12. Saccharomyces cerevisiae YJM1202 tRNA-Gln
    13. Saccharomyces cerevisiae YJM1208 tRNA-Gln
    14. Saccharomyces cerevisiae YJM1242 tRNA-Gln
    15. Saccharomyces cerevisiae YJM1244 tRNA-Gln
    16. Saccharomyces cerevisiae YJM1248 tRNA-Gln
    17. Saccharomyces cerevisiae YJM1250 tRNA-Gln
    18. Saccharomyces cerevisiae YJM1252 tRNA-Gln
    19. Saccharomyces cerevisiae YJM1273 tRNA-Gln
    20. Saccharomyces cerevisiae YJM1304 tRNA-Gln
    21. Saccharomyces cerevisiae YJM1307 tRNA-Gln
    22. Saccharomyces cerevisiae YJM1311 tRNA-Gln
    23. Saccharomyces cerevisiae YJM1326 tRNA-Gln
    24. Saccharomyces cerevisiae YJM1332 tRNA-Gln
    25. Saccharomyces cerevisiae YJM1336 tRNA-Gln
    26. Saccharomyces cerevisiae YJM1338 tRNA-Gln
    27. Saccharomyces cerevisiae YJM1341 tRNA-Gln
    28. Saccharomyces cerevisiae YJM1342 tRNA-Gln
    29. Saccharomyces cerevisiae YJM1355 tRNA-Gln
    30. Saccharomyces cerevisiae YJM1356 tRNA-Gln
    31. Saccharomyces cerevisiae YJM1381 tRNA-Gln
    32. Saccharomyces cerevisiae YJM1383 tRNA-Gln
    33. Saccharomyces cerevisiae YJM1385 tRNA-Gln
    34. Saccharomyces cerevisiae YJM1386 tRNA-Gln
    35. Saccharomyces cerevisiae YJM1387 tRNA-Gln
    36. Saccharomyces cerevisiae YJM1388 tRNA-Gln
    37. Saccharomyces cerevisiae YJM1389 tRNA-Gln
    38. Saccharomyces cerevisiae YJM1400 tRNA-Gln
    39. Saccharomyces cerevisiae YJM1401 tRNA-Gln
    40. Saccharomyces cerevisiae YJM1402 tRNA-Gln
    41. Saccharomyces cerevisiae YJM1415 tRNA-Gln
    42. Saccharomyces cerevisiae YJM1417 tRNA-Gln
    43. Saccharomyces cerevisiae YJM1418 tRNA-Gln
    44. Saccharomyces cerevisiae YJM1419 tRNA-Gln
    45. Saccharomyces cerevisiae YJM1433 tRNA-Gln
    46. Saccharomyces cerevisiae YJM1434 tRNA-Gln
    47. Saccharomyces cerevisiae YJM1439 tRNA-Gln
    48. Saccharomyces cerevisiae YJM1443 tRNA-Gln
    49. Saccharomyces cerevisiae YJM1444 tRNA-Gln
    50. Saccharomyces cerevisiae YJM1447 tRNA-Gln
    51. Saccharomyces cerevisiae YJM1450 tRNA-Gln
    52. Saccharomyces cerevisiae YJM1463 tRNA-Gln
    53. Saccharomyces cerevisiae YJM1477 tRNA-Gln
    54. Saccharomyces cerevisiae YJM1478 tRNA-Gln
    55. Saccharomyces cerevisiae YJM1479 tRNA-Gln
    56. Saccharomyces cerevisiae YJM1526 tRNA-Gln
    57. Saccharomyces cerevisiae YJM1527 tRNA-Gln
    58. Saccharomyces cerevisiae YJM1549 tRNA-Gln
    59. Saccharomyces cerevisiae YJM1573 tRNA-Gln
    60. Saccharomyces cerevisiae YJM1574 tRNA-Gln
    61. Saccharomyces cerevisiae YJM1592 tRNA-Gln
    62. Saccharomyces cerevisiae YJM1615 tRNA-Gln
    63. Saccharomyces cerevisiae YJM189 tRNA-Gln
    64. Saccharomyces cerevisiae YJM193 tRNA-Gln
    65. Saccharomyces cerevisiae YJM195 tRNA-Gln
    66. Saccharomyces cerevisiae YJM244 tRNA-Gln
    67. Saccharomyces cerevisiae YJM248 tRNA-Gln
    68. Saccharomyces cerevisiae YJM270 tRNA-Gln
    69. Saccharomyces cerevisiae YJM271 tRNA-Gln
    70. Saccharomyces cerevisiae YJM320 tRNA-Gln
    71. Saccharomyces cerevisiae YJM326 tRNA-Gln
    72. Saccharomyces cerevisiae YJM428 tRNA-Gln
    73. Saccharomyces cerevisiae YJM450 tRNA-Gln
    74. Saccharomyces cerevisiae YJM451 tRNA-Gln
    75. Saccharomyces cerevisiae YJM453 tRNA-Gln
    76. Saccharomyces cerevisiae YJM456 tRNA-Gln
    77. Saccharomyces cerevisiae YJM470 tRNA-Gln
    78. Saccharomyces cerevisiae YJM541 tRNA-Gln
    79. Saccharomyces cerevisiae YJM554 tRNA-Gln
    80. Saccharomyces cerevisiae YJM555 tRNA-Gln
    81. Saccharomyces cerevisiae YJM627 tRNA-Gln
    82. Saccharomyces cerevisiae YJM681 tRNA-Gln
    83. Saccharomyces cerevisiae YJM682 tRNA-Gln
    84. Saccharomyces cerevisiae YJM683 tRNA-Gln
    85. Saccharomyces cerevisiae YJM689 tRNA-Gln
    86. Saccharomyces cerevisiae YJM693 tRNA-Gln
    87. Saccharomyces cerevisiae YJM969 tRNA-Gln
    88. Saccharomyces cerevisiae YJM972 tRNA-Gln
    89. Saccharomyces cerevisiae YJM975 tRNA-Gln
    90. Saccharomyces cerevisiae YJM978 tRNA-Gln
    91. Saccharomyces cerevisiae YJM981 tRNA-Gln
    92. Saccharomyces cerevisiae YJM984 tRNA-Gln
    93. Saccharomyces cerevisiae YJM987 tRNA-Gln
    94. Saccharomyces cerevisiae YJM990 tRNA-Gln
    95. Saccharomyces cerevisiae YJM993 tRNA-Gln
    96. Saccharomyces cerevisiae YJM996 tRNA-Gln
    97. Saccharomyces kudriavzevii tRNA-Gln
    98. Saccharomyces mikatae tRNA-Gln
    99. Saccharomyces paradoxus tRNA-Gln
    2D structure New