Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-92b-3p URS000025576D_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, ENA, PirBase, LncBase, MirGeneDB, TarBase, miRBase). Described in 20 papers. Mus musculus (house mouse) mmu-miR-92b-3p sequence is a product of mmu-miR-92b, miR-92b, mmu-miR-92b-3p, Mir92b, miR-92b-3p, miR-92 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610007D13Rik, 0610012D09Rik, 0610030A03Rik, 0610030G24Rik, 0610038M03Rik, 0710001G09Rik, 1010001P14Rik, 1110001A17Rik, 1110001J02Rik, 1110001P04Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUUGCACUCGUCCCGGCCUCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 64 other species

    1. Alligator mississippiensis Ami-Mir-92-P1c_3p (mature (guide))
    2. Bos taurus (cattle) bta-miR-92b
    3. Callithrix jacchus cja-miR-92b
    4. Canis lupus familiaris cfa-miR-92b
    5. Cavia porcellus (domestic guinea pig) cpo-miR-92b-3p
    6. Cervus elaphus (red deer) cel-miR-92b
    7. Chrysemys picta bellii Cpi-Mir-92-P1c_3p (mature (guide))
    8. Chrysemys picta (Painted turtle) cpi-miR-92b-3p
    9. Cricetulus griseus cgr-miR-92b-3p
    10. Cyprinus carpio ccr-miR-92b
    11. Danio rerio (zebrafish) dre-miR-92b-3p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-92b-3p
    13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-92-P1c_3p (mature (guide))
    14. Eptesicus fuscus (big brown bat) efu-miR-92b
    15. Equus caballus (horse) eca-miR-92b
    16. Gallus gallus (chicken) microRNA miR-92b
    17. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-92b
    18. Homo sapiens hsa-miR-92b-3p
    19. Ictalurus punctatus (channel catfish) ipu-miR-92b
    20. Macaca mulatta mml-miR-92b-3p
    21. Maylandia zebra mze-miR-92b
    22. Monodelphis domestica mdo-miR-92b-3p
    23. Neolamprologus brichardi nbr-miR-92b
    24. Nomascus leucogenys nle-miR-92b
    25. Oreochromis niloticus oni-miR-92b
    26. Ornithorhynchus anatinus Oan-Mir-92-P1c_3p (mature (guide))
    27. Oryctolagus cuniculus (rabbit) Ocu-Mir-92-P1c_3p (mature (guide))
    28. Pan paniscus ppa-miR-92b
    29. Pan troglodytes (chimpanzee) ptr-miR-92b
    30. Pongo pygmaeus ppy-miR-92b
    31. Pteropus alecto pal-miR-92b-3p
    32. Rattus norvegicus rno-miR-92b-3p
    33. Salmo salar (Atlantic salmon) ssa-miR-92b-3p
    34. Sarcophilus harrisii Sha-Mir-92-P1c_3p (mature (guide))
    35. Scyliorhinus torazame (cloudy catshark) Sto-Mir-92-P1c_3p (mature (guide))
    36. Sus scrofa ssc-miR-92b-3p
    37. Taeniopygia guttata (zebra finch) Tgu-Mir-92-P1c_3p (mature (guide))
    38. Tor tambroides miR-92b-3p
    39. Xenopus laevis (African clawed frog) xla-miR-92b
    40. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-4946154