Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-214 URS00002524E1_7955

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Danio rerio. Annotated by 3 databases (miRBase, ENA, RefSeq). Described in 17 papers. Danio rerio (zebrafish) dre-miR-214 sequence is a product of miR-214, mir214a, dre-miR-214 genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACAGCAGGCACAGACAGGCAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 133 other species

    1. Alligator mississippiensis ami-miR-214-3p
    2. Ateles geoffroyi age-miR-214
    3. Gadus morhua gmo-miR-214-3p
    4. Gallus gallus gga-miR-214
    5. Gorilla gorilla (western gorilla) ggo-miR-214
    6. Homo sapiens (human) microRNA mir-214
    7. Macaca mulatta (Rhesus monkey) mml-miR-214-3p
    8. Macaca nemestrina (pig-tailed macaque) mne-miR-214
    9. Monodelphis domestica (gray short-tailed opossum) mdo-miR-214-3p
    10. Mus musculus Mus_musculus piRNA piR-mmu-72662
    11. Pan paniscus (pygmy chimpanzee) ppa-miR-214
    12. Pan troglodytes ptr-miR-214
    13. Pongo pygmaeus (Bornean orangutan) ppy-miR-214
    14. Rattus norvegicus rno-miR-214-3p
    15. Saguinus labiatus (red-chested mustached tamarin) sla-miR-214
    16. Sus scrofa (pig) ssc-miR-214-3p
    17. Takifugu rubripes (torafugu) fru-miR-214
    18. Tetraodon nigroviridis tni-miR-214
    19. Tor tambroides miR-214
    20. Xenopus laevis (African clawed frog) xla-miR-214-3p
    21. Xenopus tropicalis xtr-miR-214
    Publications New