Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-301b-3p URS0000251D0B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-301b: Hsa-mir-301b is a microRNA that is part of the ErbB signaling pathway network, which consists of 33 genes on circMAN1A2 [PMC5663837]. This microRNA, along with other microRNAs such as hsa-miR-494, hsa-miR-491-5p, hsa-miR-433, hsa-miR-384, hsa-miR-543, hsa-miR-107, hsa-mir-301b, hsa-miR-329, hsa-miR-152, and hsa-miR-362-3p, plays a role in regulating this pathway [PMC5663837]. The upregulation of hsa-mir-301b has been found to be associated with poor survival in patients with breast cancer [PMC6826329]. This suggests that the expression level of this microRNA may serve as a prognostic marker for breast cancer patients [PMC6826329]. The establishment of the ErbB signaling pathway network mediated by circMAN1A2 and these microRNAs provides insights into the molecular mechanisms involved in breast cancer progression [PMC5663837]. Understanding the role of these microRNAs in regulating the ErbB signaling pathway may also have implications for developing targeted therapies for breast cancer treatment [PMC5663837]. Further research is needed to fully elucidate the specific functions and mechanisms by which these microRNAs modulate the ErbB signaling pathway and contribute to breast cancer progression [PMC5663837][PMC6826329].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCAAUGAUAUUGUCAAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Canis lupus familiaris cfa-miR-301b
  2. Capra hircus (goat) chi-miR-301b
  3. Cervus elaphus Cel-miR-301b
  4. Cricetulus griseus (Chinese hamster) cgr-miR-301b
  5. Equus caballus eca-miR-301b-3p
  6. Macaca mulatta mml-miR-301b
  7. Pan troglodytes (chimpanzee) ptr-miR-301b
  8. Pongo pygmaeus (Bornean orangutan) ppy-miR-301b
Publications