Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) transfer RNA:Isoleucine-AAT 1-9 (multiple genes) secondary structure diagram

Drosophila melanogaster (fruit fly) transfer RNA:Isoleucine-AAT 1-9 (multiple genes) URS00002511E0_7227

Automated summary: This ncRNA sequence is 74 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (Rfam, GeneCards, ENA, FlyBase). Described in 16 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Drosophila melanogaster (fruit fly) transfer RNA:Isoleucine-AAT 1-9 (multiple genes) sequence is a product of tRNA:Ile-AAT-1-8, tRNA:Ile-AAT-1-6, FBgn0011884, tRNA-Ile-AAT-1-7, tRNA-Ile-AAT-1-6, FBgn0011880, tRNA-Ile-AAT-1-3, tRNA:Ile-AAT-1-3, FBgn0011881, tRNA-Ile-AAT-1-2, FBgn0011882, tRNA-Ile-AAT-1-1, FBgn0050215, tRNA:Ile-AAT-1-4, tRNA-Ile-AAT-1-4, tRNA-Ile-AAT-1-8, tRNA:Ile-AAT-1-9, FBgn0050297, FBgn0011885, tRNA:Ile-AAT-1-5, tRNA-Ile-AAT-1-5, FBgn0011883, tRNA:Ile-AAT-1-1, tRNA-Ile-AAT-1-9, tRNA:Ile-AAT-1-2, tRNA:Ile-AAT-1-7, FBgn0050509 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCCCAUUAGCUCAGUUGGUUAGAGCGUCGUGCUAAUAACGCGAAGGUCGCGGGUUCGAUCCCCUCAUGGGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 47 other species

    1. Apis mellifera tRNA Isoleucine with anticodon AAT (tRNA-Ile-AAT-1-1)
    2. Atta cephalotes (leaf-cutter ant) tRNA LOC105616925-3
    3. Atta colombica tRNA
    4. Bombus impatiens tRNA-Ile for anticodon AAU
    5. Bombus terrestris tRNA LOC110119830
    6. Bombyx mori tRNA Isoleucine with anticodon AAT (tRNA-Ile-AAT-3 1 to 10)
    7. Camponotus floridanus tRNA
    8. Ceratitis capitata tRNA-Ile
    9. Cimex lectularius (bed bug) misc RNA tRNA-Ile
    10. Cyphomyrmex costatus tRNA
    11. Danaus plexippus (monarch butterfly) tRNA-Ile for anticodon AAU
    12. Danaus plexippus plexippus tRNA
    13. Dendroctonus ponderosae tRNA-Ile for anticodon AAU
    14. Drosophila ananassae tRNA Isoleucine with anticodon AAT (tRNA-Ile-AAT-1 1 to 9)
    15. Drosophila busckii tRNA
    16. Drosophila erecta tRNA Isoleucine with anticodon AAT (tRNA-Ile-AAT-1 1 to 8)
    17. Drosophila ficusphila tRNA
    18. Drosophila guanche tRNA.Ile
    19. Drosophila persimilis tRNA Isoleucine with anticodon AAT (tRNA-Ile-AAT-1 1 to 5)
    20. Drosophila pseudoobscura pseudoobscura tRNA Isoleucine with anticodon AAT (tRNA-Ile-AAT-1 1 to 5)
    21. Drosophila sechellia tRNA Isoleucine with anticodon AAT (tRNA-Ile-AAT-1 1 to 6)
    22. Drosophila simulans tRNA Isoleucine with anticodon AAT (tRNA-Ile-AAT-1 1 to 5)
    23. Drosophila virilis tRNA Isoleucine with anticodon AAT (tRNA-Ile-AAT-1-1, tRNA-Ile-AAT-1-2)
    24. Drosophila willistoni tRNA Isoleucine with anticodon AAT (tRNA-Ile-AAT-1 1 to 9)
    25. Drosophila yakuba tRNA Isoleucine with anticodon AAT (tRNA-Ile-AAT-1 1 to 6)
    26. Dufourea novaeangliae tRNA
    27. Eumeta japonica tRNA-Ile
    28. Frieseomelitta varia tRNA-Ile
    29. Harpegnathos saltator tRNA
    30. Heliconius melpomene (postman butterfly) tRNA HMEL009153
    31. Lasius niger tRNA
    32. Lucilia cuprina tRNA-Ile for anticodon AAU
    33. Megaselia scalaris tRNA-Ile for anticodon AAU
    34. Melitaea cinxia (Glanville fritillary) tRNA-Ile for anticodon AAU
    35. Musca domestica (house fly) misc RNA MDOA003782.1
    36. Nasonia vitripennis tRNA-Ile
    37. Ooceraea biroi tRNA
    38. Operophtera brumata tRNA
    39. Oryctes borbonicus tRNA
    40. Papilio machaon tRNA
    41. Papilio xuthus tRNA
    42. Rhodnius prolixus misc RNA tRNA-Ile
    43. Solenopsis invicta tRNA-Ile
    44. Stomoxys calcitrans (stable fly) tRNA-Ile
    45. Trachymyrmex cornetzi tRNA
    46. Trachymyrmex septentrionalis tRNA
    47. Tribolium castaneum tRNA-Ile for anticodon AAU
    48. Trichomalopsis sarcophagae tRNA
    2D structure New