Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bombus impatiens tRNA-Ile for anticodon AAU secondary structure diagram

Bombus impatiens tRNA-Ile for anticodon AAU URS00002511E0_132113

Automated summary: This tRNA sequence is 74 nucleotides long and is found in Bombus impatiens. Annotated by 1 database (Ensembl Metazoa). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Bombus impatiens tRNA-Ile for anticodon AAU sequence is a product of ENSRNA022711972 gene. Found in the Bombus impatiens reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGCCCAUUAGCUCAGUUGGUUAGAGCGUCGUGCUAAUAACGCGAAGGUCGCGGGUUCGAUCCCCUCAUGGGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 100 other species

    1. Apis mellifera tRNA-Ile (AAT) (tRNA-Ile-AAT-1-1)
    2. Atta cephalotes (leaf-cutter ant) tRNA LOC105616925-3
    3. Atta colombica tRNA
    4. Bombus terrestris tRNA LOC110119830
    5. Bombyx mori tRNA-Ile (AAT) (tRNA-Ile-AAT-3 1 to 10)
    6. Camponotus floridanus tRNA
    7. Ceratitis capitata (Mediterranean fruit fly) tRNA-Ile
    8. Cimex lectularius misc RNA tRNA-Ile
    9. Cyphomyrmex costatus tRNA
    10. Danaus plexippus (monarch butterfly) tRNA-Ile for anticodon AAU
    11. Danaus plexippus plexippus tRNA
    12. Dendroctonus ponderosae tRNA-Ile for anticodon AAU
    13. Drosophila ananassae tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 9)
    14. Drosophila busckii tRNA
    15. Drosophila erecta tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 8)
    16. Drosophila ficusphila tRNA
    17. Drosophila guanche tRNA.Ile
    18. Drosophila melanogaster transfer RNA:Isoleucine-AAT 1-9 (multiple genes)
    19. Drosophila persimilis tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 5)
    20. Drosophila pseudoobscura pseudoobscura tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 5)
    21. Drosophila sechellia tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
    22. Drosophila simulans tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 5)
    23. Drosophila virilis tRNA-Ile (AAT) (tRNA-Ile-AAT-1-1, tRNA-Ile-AAT-1-2)
    24. Drosophila willistoni tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 9)
    25. Drosophila yakuba tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 6)
    26. Dufourea novaeangliae tRNA
    27. Eumeta japonica tRNA-Ile
    28. Frieseomelitta varia tRNA-Ile
    29. Harpegnathos saltator tRNA
    30. Heliconius melpomene (postman butterfly) tRNA HMEL009153
    31. Lasius niger tRNA
    32. Lucilia cuprina tRNA-Ile for anticodon AAU
    33. Megaselia scalaris tRNA-Ile for anticodon AAU
    34. Melitaea cinxia tRNA-Ile for anticodon AAU
    35. Musca domestica (house fly) misc RNA MDOA003782.1
    36. Nasonia vitripennis tRNA-Ile
    37. Ooceraea biroi tRNA
    38. Operophtera brumata tRNA
    39. Oryctes borbonicus tRNA
    40. Papilio machaon tRNA
    41. Papilio xuthus tRNA
    42. Pararge aegeria tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 14)
    43. Plutella xylostella (diamondback moth) tRNA-Ile
    44. Rhodnius prolixus misc RNA tRNA-Ile
    45. Solenopsis invicta tRNA-Ile
    46. Spodoptera frugiperda tRNA-Ile (AAT) (tRNA-Ile-AAT-1 1 to 14)
    47. Stomoxys calcitrans (stable fly) tRNA-Ile
    48. Trachymyrmex cornetzi tRNA
    49. Trachymyrmex septentrionalis tRNA
    50. Tribolium castaneum (red flour beetle) tRNA-Ile for anticodon AAU
    51. Trichomalopsis sarcophagae tRNA
    2D structure New