Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1248 SNR31 secondary structure diagram

Saccharomyces cerevisiae YJM1248 SNR31 URS000024F0F7_1294340

Automated summary: This snoRNA sequence is 225 nucleotides long and is found in Saccharomyces cerevisiae YJM1248. Annotated by 1 database (ENA). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR31, RF01257).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GAAGCAAAAUUACACCAUGAGUUCCUAUUAACGUCAGCCUCUUUUGUACUCAUAAUGUGGCUUCGGAUGUUUGAUGGGCGUUGCUUCAGUGCGUACGGCUCAUGGUAGAUUAAUUAUUAGAAAGAUGUAUCUCCAGCUGUUGAUAUUAGAGGGGGAAGCCUUUCUCUUUCACCUCGCCUUUUUAAACACCUGAUACAGUUGGUCAUGAUUCGUUCUACAUUUUAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Saccharomyces cerevisiae small nucleolar RNA snR31
    2. Saccharomyces cerevisiae S288C Small Nucleolar RNA
    3. Saccharomyces cerevisiae YJM1208 SNR31
    4. Saccharomyces cerevisiae YJM1386 SNR31
    5. Saccharomyces cerevisiae YJM1401 SNR31
    6. Saccharomyces cerevisiae YJM1418 SNR31
    7. Saccharomyces cerevisiae YJM1439 SNR31
    8. Saccharomyces cerevisiae YJM1443 SNR31
    9. Saccharomyces cerevisiae YJM1447 SNR31
    10. Saccharomyces cerevisiae YJM1615 SNR31
    11. Saccharomyces cerevisiae YJM195 SNR31
    12. Saccharomyces cerevisiae YJM428 SNR31
    13. Saccharomyces cerevisiae YJM627 SNR31
    2D structure