Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) microRNA dme-mir-31b precursor secondary structure diagram

Drosophila melanogaster (fruit fly) microRNA dme-mir-31b precursor URS000024E35C_7227

Automated summary: This pre miRNA sequence is 127 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (miRBase, ENA, FlyBase, RefSeq). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-31, RF00661). Drosophila melanogaster (fruit fly) microRNA dme-mir-31b precursor sequence is a product of FBgn0262369, 31b precursor RN, dme-mir-31b precursor, 31b, mir-31b precursor RNA, mir-31b, mir-31b precurso, 31, mir-31b precursor, 31b precursor RNA genes. Found in the fruit fly reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CAAAUAAUGAAUUUGGCAAGAUGUCGGAAUAGCUGAGAGCACAGCGGAUCGAACAUUUUAUCGUCCGAAAAAAUGUGAUUAUUUUUGAAAAGCGGCUAUGCCUCAUCUAGUCAAUUGCAUUACUUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    2D structure Publications New