Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-433-3p URS000024DFCE_9940

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAUGAUGGGCUCCUCGGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus (cattle) bta-miR-433
  2. Canis lupus familiaris cfa-miR-433
  3. Capra hircus chi-miR-433
  4. Cavia porcellus cpo-miR-433-3p
  5. Dasypus novemcinctus dno-miR-433-3p
  6. Echinops telfairi Ete-Mir-433_3p (mature (guide))
  7. Equus caballus (horse) eca-miR-433
  8. Homo sapiens (human) hsa-miR-433-3p
  9. Macaca mulatta (Rhesus monkey) mml-miR-433-3p
  10. Mus musculus mmu-miR-433-3p
  11. Oryctolagus cuniculus (rabbit) ocu-miR-433-3p
  12. Pan troglodytes ptr-miR-433
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-433
  14. Pteropus alecto pal-miR-433-3p
  15. Rattus norvegicus (Norway rat) rno-miR-433-3p
Publications