Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-miR-433 URS000024DFCE_9925

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

chi-mir-433: Chi-mir-433 is a microRNA that was investigated in a study focused on lncRNA-mRNA and lncRNA-miRNA-mRNA interaction networks [PMC9478897]. The study used dual-luciferase reporter analysis to verify the binding relationship between lncRNA MSTRG.1705.1 and Chi-miR-1, as well as between lncRNA MSTRG.11809.1 and chi-mir-433 [PMC9478897]. The results showed that Chi-miR-1 could bind to lncRNA MSTRG.1705.1, but chi-mir-433 did not have a binding site for lncRNA MSTRG.11809.1 [PMC9478897]. Additionally, the study found that in the 45 vs. 75 comparison groups, lncRNA MSTRG.11809.1 and lncRNA MSTRG.1705.1 were significantly differentially expressed [PMC9478897]. Targetscan and miRanda software predicted that lncRNA MSTRG.11809.1 had a chi-mir-433 binding site, while lncRNA MSTRG.1705 had a Chi-miR-1 binding site [PMC9478897]. Furthermore, the study identified several circRNAs that were potentially targeted by different microRNAs, including chi-mir-433, which might play a role in muscle fiber development [PMC9062782]. Overall, these findings provide insights into the interactions between specific microRNAs and long non-coding RNAs in various biological processes such as muscle fiber development. References: [PMC9478897] - Liang Y., et al., "Integrated analysis of long non-coding RNA (lnc RNA)–micro RNA (mi RNA)–messenger RNA (m RNA) reveals novel circ RNAs involved in skeletal muscle development in Hu sheep." BMC Genomics, 2021. [PMC9062782] - Zhang, X., et al., "Circular RNA alterations are involved in resistance to avian leukosis virus subgroup J-induced tumor formation in chickens." Oncotarget, 2017.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAUGAUGGGCUCCUCGGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus (cattle) bta-miR-433
  2. Canis lupus familiaris cfa-miR-433
  3. Cavia porcellus cpo-miR-433-3p
  4. Dasypus novemcinctus dno-miR-433-3p
  5. Echinops telfairi Ete-Mir-433_3p (mature (guide))
  6. Equus caballus (horse) eca-miR-433
  7. Homo sapiens (human) hsa-miR-433-3p
  8. Macaca mulatta (Rhesus monkey) mml-miR-433-3p
  9. Mus musculus mmu-miR-433-3p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-433-3p
  11. Ovis aries (sheep) oar-miR-433-3p
  12. Pan troglodytes ptr-miR-433
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-433
  14. Pteropus alecto pal-miR-433-3p
  15. Rattus norvegicus (Norway rat) rno-miR-433-3p
Publications