Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-433 URS000024DFCE_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-433: Bta-mir-433, a microRNA, has been identified to bind to the mRNA of the human RTL1 gene at the same positions as hsa-miR-433 [Davis et al., 2005; Yurikova et al., 2019] [PMC8787201]. Humans possess several identical miRNAs for bta-miR-433 [PMC8787201]. Bta-mir-433 is among the miRNAs that target the RTL1 gene, along with bta-miR-136, bta-miR-432, bta-miR-127, and bta-miR-431 [PMC8787201]. A study on differential expression of miRNAs revealed that bta-mir-433 was under-expressed with a decreased fold-change of 3.99 [PMC7312616]. Furthermore, bta-mir-433 has been found to exhibit higher expression levels in mature testicular tissue [PMC8614260]. Another study on differential expression patterns confirmed that bta-mir-433 displayed differential expression as determined by RNA-seq and stem-loop RT-qPCR [PMC4840452]. Additionally, in a study on gene expression in infected compartments, it was observed that the expression of bta-mir-433 was downregulated compared to the control [PMC4840452]. These findings collectively emphasize the involvement and differential expression patterns of bta-mir-433 in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAUGAUGGGCUCCUCGGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Canis lupus familiaris cfa-miR-433
  2. Capra hircus chi-miR-433
  3. Cavia porcellus cpo-miR-433-3p
  4. Dasypus novemcinctus dno-miR-433-3p
  5. Echinops telfairi Ete-Mir-433_3p (mature (guide))
  6. Equus caballus (horse) eca-miR-433
  7. Homo sapiens (human) hsa-miR-433-3p
  8. Macaca mulatta (Rhesus monkey) mml-miR-433-3p
  9. Mus musculus mmu-miR-433-3p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-433-3p
  11. Ovis aries (sheep) oar-miR-433-3p
  12. Pan troglodytes ptr-miR-433
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-433
  14. Pteropus alecto pal-miR-433-3p
  15. Rattus norvegicus (Norway rat) rno-miR-433-3p
Publications