Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-433-3p URS000024DFCE_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (ENA, LncBase, TarBase, MalaCards, GeneCards, RefSeq, miRBase, IntAct, MirGeneDB). Described in 45 papers. Homo sapiens (human) hsa-miR-433-3p sequence is a product of hsa-miR-433-3p, miR-433-3p, MIR433, miR-433, hsa-miR-433 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 14-3-3-zeta, 14-3-3GAMMA, 14-3-3γ, AAKG, AAKG2, ABI-1, ABI1, ABR, ACP1, ACS4.

Interactions 2

According to IntAct, Homo sapiens (human) hsa-miR-433-3p interacts with:

Interaction id Participant Synonyms
EBI-22117749 intact:EBI-20740126 EBI-20740126 ENST00000640368 mrna_pax6
EBI-22117760 intact:EBI-22117770 EBI-22117770 ENST00000651671 mrna_notch1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUCAUGAUGGGCUCCUCGGUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 24 other species

    1. Bos taurus (cattle) bta-miR-433
    2. Canis lupus familiaris cfa-miR-433
    3. Capra hircus chi-miR-433
    4. Cavia porcellus (domestic guinea pig) cpo-miR-433-3p
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-433-3p
    6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-433_3p (mature (guide))
    7. Equus caballus (horse) eca-miR-433
    8. Macaca mulatta mml-miR-433-3p
    9. Mus musculus (house mouse) mmu-miR-433-3p
    10. Oryctolagus cuniculus (rabbit) ocu-miR-433-3p
    11. Ovis aries oar-miR-433-3p
    12. Pan troglodytes (chimpanzee) ptr-miR-433
    13. Pongo pygmaeus ppy-miR-433
    14. Pteropus alecto pal-miR-433-3p
    15. Rattus norvegicus rno-miR-433-3p