Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-433-3p URS000024DFCE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-433: Hsa-mir-433 is a microRNA that has been studied in various cancer types, including DLBCL and LIHC. In DLBCL, it has been found that hsa-mir-433 is negatively associated with GATA3 and positively associated with SOX9 [PMC8777518]. In LIHC, hsa-mir-433 is positively associated with hsa-mir-429 [PMC8777518]. Hsa-mir-433 has also been investigated in ovarian cancer cells treated with paclitaxel, where it was found to be stably expressed [PMC4430267]. Furthermore, hsa-mir-433 has been identified as one of the miRNAs present in both human and bovine RTL1 gene mRNA binding sites [PMC8787201]. In synucleinopathies such as MSA and PD, hsa-mir-433 was found to be downregulated [PMC9222420]. Additionally, hsa-mir-433 has been identified as one of the miRNAs involved in myogenic differentiation and TNF-α treatment [PMC4325962]. Finally, a negative correlation was observed between hsa-mir-433 and ASCL1 in a network analysis [PMC8777518]. References: [PMC8777518] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8777518/ [PMC4430267] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4430267/ [PMC8787201] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8787201/ [PMC9222420] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9222420/ [PCM4325962] - https://www.ncbi.nlm.nih.gov/pmc/articles/PCM4325962/

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCAUGAUGGGCUCCUCGGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus (cattle) bta-miR-433
  2. Canis lupus familiaris cfa-miR-433
  3. Capra hircus chi-miR-433
  4. Cavia porcellus cpo-miR-433-3p
  5. Dasypus novemcinctus dno-miR-433-3p
  6. Echinops telfairi Ete-Mir-433_3p (mature (guide))
  7. Equus caballus (horse) eca-miR-433
  8. Macaca mulatta (Rhesus monkey) mml-miR-433-3p
  9. Mus musculus mmu-miR-433-3p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-433-3p
  11. Ovis aries (sheep) oar-miR-433-3p
  12. Pan troglodytes ptr-miR-433
  13. Pongo pygmaeus (Bornean orangutan) ppy-miR-433
  14. Pteropus alecto pal-miR-433-3p
  15. Rattus norvegicus (Norway rat) rno-miR-433-3p
Publications