Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-433-3p URS000024DFCE_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 6 databases (ENA, MirGeneDB, PirBase, RefSeq, TarBase, miRBase). Described in 21 papers. Mus musculus (house mouse) mmu-miR-433-3p sequence is a product of mmu-miR-433, Mir433, miR-433-3p, miR-433, mmu-miR-433-3p genes. Interacts with protein-coding genes, including 2310051E17Rik, 2610511F20Rik, 4632423N09Rik, 5730499P16Rik, 90 kDa, BTEB-1, Bteb1, C/EBPgamma, C86145, CDP.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUCAUGAUGGGCUCCUCGGUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 24 other species

    1. Bos taurus (cattle) bta-miR-433
    2. Canis lupus familiaris cfa-miR-433
    3. Capra hircus chi-miR-433
    4. Cavia porcellus (domestic guinea pig) cpo-miR-433-3p
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-433-3p
    6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-433_3p (mature (guide))
    7. Equus caballus (horse) eca-miR-433
    8. Homo sapiens hsa-miR-433-3p
    9. Macaca mulatta mml-miR-433-3p
    10. Oryctolagus cuniculus (rabbit) ocu-miR-433-3p
    11. Ovis aries oar-miR-433-3p
    12. Pan troglodytes (chimpanzee) ptr-miR-433
    13. Pongo pygmaeus ppy-miR-433
    14. Pteropus alecto pal-miR-433-3p
    15. Rattus norvegicus rno-miR-433-3p