Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-758-3p URS000024B619_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (PSICQUIC, RefSeq, miRBase, GeneCards, IntAct, TarBase, MalaCards, ENA, MirGeneDB). Homo sapiens (human) hsa-miR-758-3p sequence is a product of hsa-miR-758-3p, hsa-miR-758, miR-758-3p, miR-758, MIR758 genes. Found in the human reference genome. Interacts with protein-coding genes, including AAVS1, ABP125, ABP130, ACTDP, ADF, AF17, AIB3, ALIEN, ANKRD17, AP3M1.

Interactions 8

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-758-3p interacts with:

Interaction id Participant Synonyms
EBI-27103905 intact:EBI-27104134 EBI-27104134 ENST00000367468 mrna_ptgs2
URS000024B619_9606-0 O95477 O95477
URS000024B619_9606-6 O95477 O95477
URS000024B619_9606-1 P05019 P05019
URS000024B619_9606-2 P61764 P61764
URS000024B619_9606-3 Q15375 Q15375
URS000024B619_9606-4 Q9H2H9 Q9H2H9
URS000024B619_9606-5 Q9P121 Q9P121

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UUUGUGACCUGGUCCACUAACC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 12 other species

    1. Bos taurus (cattle) bta-miR-758
    2. Canis lupus familiaris cfa-miR-758
    3. Capra hircus chi-miR-758
    4. Cavia porcellus (domestic guinea pig) cpo-miR-758-3p
    5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-758-3p
    6. Echinops telfairi Ete-Mir-154-P26_3p (mature (guide))
    7. Equus caballus eca-miR-758
    8. Gorilla gorilla (western gorilla) ggo-miR-758
    9. Pan troglodytes ptr-miR-758
    10. Pongo pygmaeus (Bornean orangutan) ppy-miR-758
    11. Pteropus alecto pal-miR-758-3p
    12. Rattus norvegicus rno-miR-758-3p
    Publications New