Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-509-5p URS000024AD66_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-509: Hsa-mir-509 is a microRNA that has been implicated in various biological processes and diseases, including cocaine dependence, cancer, and metastasis [PMC4930134] [PMC4505902] [PMC6685408] [PMC6276827]. It has been shown that the risk allele for cocaine dependence, rs1437134G, leads to a decreased expression of NFAT5, and this effect is more pronounced in the presence of hsa-mir-509 [PMC4930134]. Additionally, rs1437134 and another variant, rs11641233, have been predicted to alter the binding of hsa-mir-509 to NFAT5 messenger RNA [PMC4930134]. Hsa-mir-509 has also been found to play a role in suppressing brain metastasis in breast cancer and pancreatic cancer patients [PMC6276827]. Furthermore, hsa-mir-509 has been shown to inhibit tumor cell invasion and migration in various cancers such as lung cancer, breast cancer, renal cell cancer, and pancreatic cancer [PMC6276827]. However, the expression level of hsa-mir-509 may not have a significant relationship with overall survival in patients with certain diseases such as glioma or gastric cancer [PMC8046546]. In summary, hsa-mir-509 is a microRNA that is involved in various biological processes and diseases. It can modulate gene expression and affect disease outcomes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACUGCAGACAGUGGCAAUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications