Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-128-3p URS000024A59E_9031

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (RefSeq, miRBase, ENA, MirGeneDB). Described in 7 papers. Gallus gallus (chicken) gga-miR-128-3p sequence is a product of gga-miR-128, miR-128-3p, gga-miR-128-3p, MIR128-1, miR-128, MIR128-2 genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCACAGUGAACCGGUCUCUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 46 other species

    1. Alligator mississippiensis ami-miR-128-3p
    2. Anolis carolinensis aca-miR-128-3p
    3. Bos taurus (cattle) bta-miR-128
    4. Callithrix jacchus cja-miR-128
    5. Callorhinchus milii (elephant shark) eshark_mir-128_1
    6. Canis lupus familiaris cfa-miR-128
    7. Capra hircus (goat) chi-miR-128-3p
    8. Cavia porcellus (domestic guinea pig) cpo-miR-128-3p
    9. Cervus elaphus (red deer) cel-miR-128
    10. Chiloscyllium plagiosum microRNA cpl-miR-128
    11. Chrysemys picta bellii Cpi-Mir-128-P1_3p (mature (guide))
    12. Chrysemys picta cpi-miR-128-3p
    13. Columba livia cli-miR-128-3p
    14. Cricetulus griseus (Chinese hamster) cgr-miR-128-3p
    15. Cyprinus carpio ccr-miR-128
    16. Danio rerio (zebrafish) Dre-Mir-128-P1b_3p (mature (guide))
    17. Dasypus novemcinctus (nine-banded armadillo) dno-miR-128-3p
    18. Echinops telfairi Ete-Mir-128-P1_3p (mature (guide))
    19. Equus caballus (horse) eca-miR-128
    20. Gadus morhua (Atlantic cod) gmo-miR-128-3p
    21. Haplochromis burtoni abu-miR-128
    22. Homo sapiens hsa-miR-128-3p
    23. Ictalurus punctatus (channel catfish) ipu-miR-128
    24. Macaca mulatta (Rhesus monkey) mml-miR-128b-3p
    25. Maylandia zebra mze-miR-128
    26. Microcebus murinus mmr-miR-128
    27. Monodelphis domestica (gray short-tailed opossum) mdo-miR-128a-3p
    28. Mus musculus mmu-miR-128-3p
    29. Nomascus leucogenys nle-miR-128
    30. Oreochromis niloticus oni-miR-128
    31. Ornithorhynchus anatinus (platypus) oan-miR-128-3p
    32. Oryctolagus cuniculus (rabbit) ocu-miR-128a-3p
    33. Otolemur garnettii oga-miR-128
    34. Pan troglodytes (chimpanzee) ptr-miR-128
    35. Pongo pygmaeus ppy-miR-128
    36. Pteropus alecto pal-miR-128-3p
    37. Pundamilia nyererei pny-miR-128
    38. Python bivittatus pbv-miR-128-3p
    39. Rattus norvegicus (Norway rat) rno-miR-128-3p
    40. Salmo salar (Atlantic salmon) ssa-miR-128-3p
    41. Sarcophilus harrisii (Tasmanian devil) sha-miR-128
    42. Scyliorhinus torazame (cloudy catshark) Sto-Mir-128-P1_3p (mature (guide))
    43. Sus scrofa (pig) ssc-miR-128
    44. Taeniopygia guttata tgu-miR-128-3p
    45. Tupaia chinensis (Chinese tree shrew) tch-miR-128
    46. Xenopus laevis (African clawed frog) xla-miR-128-3p
    47. Xenopus tropicalis Xtr-Mir-128-P1_3p (mature (guide))