Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Microcebus murinus (gray mouse lemur) mmr-miR-128 URS000024A59E_30608

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Microcebus murinus. Annotated by 1 database (miRBase). Described in 0 papers. Found in the gray mouse lemur reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCACAGUGAACCGGUCUCUUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 106 other species

    1. Alligator mississippiensis ami-miR-128-3p
    2. Anolis carolinensis aca-miR-128-3p
    3. Bos taurus (cattle) bta-miR-128
    4. Callithrix jacchus cja-miR-128
    5. Callorhinchus milii (elephant shark) eshark_mir-128_1
    6. Canis lupus familiaris cfa-miR-128
    7. Capra hircus chi-miR-128-3p
    8. Cavia porcellus (domestic guinea pig) cpo-miR-128-3p
    9. Cervus elaphus (red deer) cel-miR-128
    10. Chiloscyllium plagiosum microRNA cpl-miR-128
    11. Chrysemys picta bellii Cpi-Mir-128-P1_3p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-miR-128-3p
    13. Columba livia (rock pigeon) cli-miR-128-3p
    14. Cricetulus griseus cgr-miR-128-3p
    15. Cyprinus carpio ccr-miR-128
    16. Danio rerio (zebrafish) Dre-Mir-128-P1b_3p (mature (guide))
    17. Dasypus novemcinctus (nine-banded armadillo) dno-miR-128-3p
    18. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-128-P1_3p (mature (guide))
    19. Equus caballus (horse) eca-miR-128
    20. Gadus morhua gmo-miR-128-3p
    21. Gallus gallus (chicken) gga-miR-128-3p
    22. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-128
    23. Homo sapiens hsa-miR-128-3p
    24. Ictalurus punctatus (channel catfish) ipu-miR-128
    25. Macaca mulatta mml-miR-128b-3p
    26. Maylandia zebra mze-miR-128
    27. Monodelphis domestica mdo-miR-128a-3p
    28. Mus musculus (house mouse) mmu-miR-128-3p
    29. Nomascus leucogenys nle-miR-128
    30. Oreochromis niloticus oni-miR-128
    31. Ornithorhynchus anatinus oan-miR-128-3p
    32. Oryctolagus cuniculus (rabbit) ocu-miR-128a-3p
    33. Otolemur garnettii oga-miR-128
    34. Pan troglodytes (chimpanzee) ptr-miR-128
    35. Pongo pygmaeus ppy-miR-128
    36. Pteropus alecto pal-miR-128-3p
    37. Pundamilia nyererei pny-miR-128
    38. Python bivittatus pbv-miR-128-3p
    39. Rattus norvegicus rno-miR-128-3p
    40. Salmo salar (Atlantic salmon) ssa-miR-128-3p
    41. Sarcophilus harrisii sha-miR-128
    42. Scyliorhinus torazame (cloudy catshark) Sto-Mir-128-P1_3p (mature (guide))
    43. Sus scrofa ssc-miR-128
    44. Taeniopygia guttata (zebra finch) tgu-miR-128-3p
    45. Tupaia chinensis tch-miR-128
    46. Xenopus laevis (African clawed frog) xla-miR-128-3p
    47. Xenopus tropicalis Xtr-Mir-128-P1_3p (mature (guide))