Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-29b URS000024463E_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-miR-29b: ssc-mir-29b is a microRNA that has been identified in various studies and has been found to play a role in different biological processes. In the context of IAV infection in pigs, ssc-mir-29b was found to be modestly up-regulated on day 1 and 3 after challenge, suggesting its involvement in the antiviral response [PMC5909910]. It was also found to be up-regulated in sexually mature HZ boars and was associated with testicular development and spermatogenesis [PMC9622794]. Additionally, ssc-mir-29b was identified as one of the miRNAs that may regulate precocious sexual maturation traits in HZ boars [PMC9622794]. In another study, ssc-mir-29b was found to be upregulated at 2W compared with BW [PMC8367414]. It has also been implicated in the regulation of signaling pathways such as NF-κB and JAK-STAT [PMC7820490]. Furthermore, ssc-mir-29b expression was found to be differentially regulated during infection with different strains of IAV [PMC7820490]. The size of ssc-mir-29b has also been compared to miRBase entries, showing some differences [PMC3026822]. Overall, these studies highlight the diverse roles and regulation of ssc-mir-29b in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCACCAUUUGAAAUCAGUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 45 other species

  1. Alligator mississippiensis Ami-Mir-29-P1b-v1_3p (mature (guide))
  2. Anolis carolinensis Aca-Mir-29-P1d-v1_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-29b
  4. Bos taurus (cattle) bta-miR-29b
  5. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-29b
  6. Callorhinchus milii (elephant shark) Cmi-Mir-29-P1b_3p (mature (guide))
  7. Canis lupus familiaris cfa-miR-29b
  8. Cavia porcellus cpo-miR-29b-3p
  9. Chrysemys picta bellii Cpi-Mir-29-P1b-v1_3p (mature (guide))
  10. Columba livia (rock pigeon) cli-miR-29b-3p
  11. Cricetulus griseus cgr-miR-29b-3p
  12. Cyprinus carpio ccr-miR-29b
  13. Danio rerio (zebrafish) dre-miR-29b3-3p
  14. Dasypus novemcinctus dno-miR-29b-3p
  15. Echinops telfairi Ete-Mir-29-P1b-v1_3p (mature (guide))
  16. Equus caballus eca-miR-29b
  17. Gallus gallus (chicken) gga-miR-29b-3p
  18. Gekko japonicus Gja-Mir-29-P1b-v1_3p (mature (guide))
  19. Homo sapiens (human) hsa-miR-29b-3p
  20. Latimeria chalumnae Lch-Mir-29-P1b_3p (mature (guide))
  21. Lepisosteus oculatus (spotted gar) Loc-Mir-29-P1b-v1_3p (mature (guide))
  22. Macaca mulatta (Rhesus monkey) mml-miR-29b-3p
  23. Maylandia zebra (zebra mbuna) mze-miR-29b
  24. Microcaecilia unicolor Mun-Mir-29-P1d-v1_3p (mature (guide))
  25. Microcebus murinus (gray mouse lemur) mmr-miR-29b
  26. Monodelphis domestica Mdo-Mir-29-P1b-v1_3p (mature (guide))
  27. Monopterus albus Mal-Mir-29-P1d2-v1_3p (mature (guide))
  28. Mus musculus (house mouse) mmu-miR-29b-3p
  29. Neolamprologus brichardi (lyretail cichlid) nbr-miR-29b
  30. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-29b
  31. Ophiophagus hannah (king cobra) oha-miR-29b-3p
  32. Ornithorhynchus anatinus Oan-Mir-29-P1b-v1_3p (mature (guide))
  33. Oryctolagus cuniculus ocu-miR-29b-3p
  34. Otolemur garnettii (small-eared galago) oga-miR-29b
  35. Pteropus alecto pal-miR-29b-3p
  36. Python bivittatus Pbv-Mir-29-P1d-v1_3p (mature (guide))
  37. Rattus norvegicus rno-miR-29b-3p
  38. Saccoglossus kowalevskii Sko-Mir-29-P1_3p (mature (guide))
  39. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-29-P1b-v1_3p (mature (guide))
  40. Scyliorhinus torazame (cloudy catshark) Sto-Mir-29-P1d_3p (mature (guide))
  41. Sphenodon punctatus (tuatara) Spt-Mir-29-P1b_3p (mature (guide))
  42. Taeniopygia guttata Tgu-Mir-29-P1b-v1_3p (mature (guide))
  43. Tupaia chinensis tch-miR-29b-3p
  44. Xenopus laevis xla-miR-29b-3p
  45. Xenopus tropicalis xtr-miR-29b
Publications