Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ornithorhynchus anatinus (platypus) Oan-Mir-29-P1b-v1_3p (mature (guide)) URS000024463E_9258

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Ornithorhynchus anatinus. Annotated by 1 database (MirGeneDB). Found in the platypus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UAGCACCAUUUGAAAUCAGUGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 45 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-29-P1b-v1_3p (mature (guide))
    2. Anolis carolinensis Aca-Mir-29-P1d-v1_3p (mature (guide))
    3. Artibeus jamaicensis aja-miR-29b
    4. Bos taurus bta-miR-29b
    5. Callithrix jacchus cja-miR-29b
    6. Callorhinchus milii (elephant shark) Cmi-Mir-29-P1b_3p (mature (guide))
    7. Canis lupus familiaris (dog) cfa-miR-29b
    8. Cavia porcellus (domestic guinea pig) cpo-miR-29b-3p
    9. Chrysemys picta bellii Cpi-Mir-29-P1b-v1_3p (mature (guide))
    10. Columba livia (rock pigeon) cli-miR-29b-3p
    11. Cricetulus griseus (Chinese hamster) cgr-miR-29b-3p
    12. Cyprinus carpio (common carp) ccr-miR-29b
    13. Danio rerio dre-miR-29b3-3p
    14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-29b-3p
    15. Echinops telfairi Ete-Mir-29-P1b-v1_3p (mature (guide))
    16. Equus caballus (horse) eca-miR-29b
    17. Gallus gallus gga-miR-29b-3p
    18. Gekko japonicus Gja-Mir-29-P1b-v1_3p (mature (guide))
    19. Homo sapiens hsa-miR-29b-3p
    20. Latimeria chalumnae Lch-Mir-29-P1b_3p (mature (guide))
    21. Lepisosteus oculatus (spotted gar) Loc-Mir-29-P1b-v1_3p (mature (guide))
    22. Macaca mulatta (Rhesus monkey) mml-miR-29b-3p
    23. Maylandia zebra mze-miR-29b
    24. Microcaecilia unicolor Mun-Mir-29-P1d-v1_3p (mature (guide))
    25. Microcebus murinus mmr-miR-29b
    26. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-29-P1b-v1_3p (mature (guide))
    27. Monopterus albus Mal-Mir-29-P1d2-v1_3p (mature (guide))
    28. Mus musculus (house mouse) mmu-miR-29b-3p
    29. Neolamprologus brichardi nbr-miR-29b
    30. Nomascus leucogenys nle-miR-29b
    31. Ophiophagus hannah (king cobra) oha-miR-29b-3p
    32. Oryctolagus cuniculus (rabbit) ocu-miR-29b-3p
    33. Otolemur garnettii oga-miR-29b
    34. Pteropus alecto (black flying fox) pal-miR-29b-3p
    35. Python bivittatus Pbv-Mir-29-P1d-v1_3p (mature (guide))
    36. Rattus norvegicus (Norway rat) rno-miR-29b-3p
    37. Saccoglossus kowalevskii Sko-Mir-29-P1_3p (mature (guide))
    38. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-29-P1b-v1_3p (mature (guide))
    39. Scyliorhinus torazame Sto-Mir-29-P1d_3p (mature (guide))
    40. Sphenodon punctatus Spt-Mir-29-P1b_3p (mature (guide))
    41. Sus scrofa ssc-miR-29b
    42. Taeniopygia guttata (zebra finch) Tgu-Mir-29-P1b-v1_3p (mature (guide))
    43. Tupaia chinensis (Chinese tree shrew) tch-miR-29b-3p
    44. Xenopus laevis xla-miR-29b-3p
    45. Xenopus tropicalis xtr-miR-29b